cryptocephal
Fly Line IDF000106
Construct IDP000084
CG/CR NumberCG8669
Symbolcrc
Gene Namecryptocephal
Gene SynonymsCG8669; dATF-4; ATF-4; 929; l(2)crc; crc; ATF4/crc; Ire1;
Atf4; ATF4; dATF4
FBgnFBgn0000370
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAGCACCTATATATTTATGCAAGCATATGAATGTCTTTTGGACCAAAA
GGCAACGTTGAACTGCATCGATTATGACAGTAACAGCTTTCAGCCGAACA
TTAATGTTATAACTCAGGCCATAGTACCCGCAAACAAAGTACAATTCGGT
GCATCTTCAGACGCTGCTTCGCTTCCTTCTGCCGCTGATTACCAGCTCAA
TGATGGCCCATCCCTTATTCTACAGCAATTAACGCCGCCGCAGTCTCCGC
CTCAATTCGATGCTTACAAACAGGCGGGCGATGCACAGCCAAAACCCGTG
CTCGTAAAGGCCGAGCAAAAGGTGCAATGCTATACTCCTGATGTTACACA
CGCAGCATCTGCCACGCCCTTTAACTTTACCAACTGGGTAGGCGGCAGCG
AAATTGCCCGAGAGAACCAACTGGTCGATGATATCGTCAATATGCGTGCT
AAGGAGCTCGAATTGTCCACGAACTGGCAGCAGCTCAATGAGGACTGCGA
GTCTCAGGCGTCTTCATCTTTAGACAGCAGAAGCACAGGAAGCGGAGTGT
GCAGCAGCATCGCCGACGCCGACGAGGACTGGGTTCCAGAGCTTATCAGC
AGCTCCTCCTCGCCAGCTCCTACAACCATCGAGCAGTCTGCGTCCCAGCC
AAAAAAGCGTACTCGCACTTACGGGCGCGGTGTAGAGGATCGAAAGATCA
GGAAAAAGGAGCAGAACAAGAACGCTGCCACACGATATCGCCAGAAAAAG
AAACTTGAAATGGAGAATGTGCTGGGCGAGGAGCATGTGCTGTCTAAAGA
AAACGAGCAGCTTCGTCGCACTCTGCAGGAGCGGCACAACGAAATGCGCT
ATCTGCGCCAGCTGATTCGAGAGTTCTACCATGAACGCAAGCGC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items