cousin of atonal
Fly Line IDF000077
Construct IDP000033
CG/CR NumberCG7760
Symbolcato
Gene Namecousin of atonal
Gene SynonymsCato; DATH-B; CG7760; cato; bHLHa12
FBgnFBgn0024249
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAGCTACTACTACTCGTCTGCCTCCGAGGAGGATGGCAGTTCCCAGTA
CCTGGGCAGTCCCAACTACAACTTGACCCAGTTGCCGCCAGTTTCTGGCC
AGGATTACGGACAGGGGGCTTTCTTATCGCCGGAATGGCAATTCTTGGAT
GCCGCAGGCGGAACTCAAACGGAACTAGGACCCATCATGGAGGCGCAAGG
ACAGCACACCCAGCCGCAGACCAAACGGCGGAGTAACAGCTTCACAGGAT
CGGACGGTAGGAAGAGCAGTCCAGAGCAGACCAATCTCAGTCCCACGGTC
CAGAAAAGGAGACGACAGGCTGCCAATGCGCGGGAAAGGAAGCGGATGAA
TGGATTGAATGCGGCTTTCGAGCGCCTAAGGGAAGTGGTGCCCGCTCCAT
CCATTGACCAGAAATTGTCCAAGTTCGAGACTCTCCAGATGGCGCAGTCC
TACATCCTGGCGCTGTGCGATCTCCTCAACAACGGGGACGTGGAAGTGGA
TGCCGCTGCATACACCATCTTCGGCGACAGCGATAGTGGATTTGGATTGA
GCGGAGGATCCTTGTCA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items