extradenticle
Fly Line IDF000036
Construct IDP000096
CG/CR NumberCG8933
Symbolexd
Gene Nameextradenticle
Gene SynonymsExd; Dm-EXD; DExd; EXD; Dpbx; unnamed; td48; l(1)IV; anon
-EST:fe1H3; Pbx1; CG8933; exd; lincRNA.S9404
FBgnFBgn0000611
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGAGGACCCCAATCGCATGTTGGCCCACACCGGCGGCATGATGGCTCC
GCAAGGATACGGCTTGTCTGGCCAGGATGATGGCCAGAATGCCGGCAGCG
AGAACGAGGTGCGCAAGCAGAAGGACATCGGCGAGATATTGCAACAGATA
ATGAGTATCTCGGAGCAATCACTTGACGAGGCCCAGGCCAGAAAACATAC
ACTAAACTGTCACCGAATGAAGCCGGCACTTTTCTCTGTACTTTGCGAAA
TCAAGGAGAAGACCGTCCTCTCGATTCGCAACACCCAGGAGGAGGAGCCC
CCAGATCCGCAACTGATGCGCTTGGACAACATGCTGATTGCCGAGGGCGT
GGCCGGACCCGAGAAGGGCGGTGGCGGAGCAGCGGCTGCCTCTGCGGCTG
CGGCCAGCCAGGGCGGTTCCCTGTCCATCGATGGTGCTGACAATGCCATT
GAGCATTCCGACTACCGTGCCAAGCTGGCACAGATCCGTCAAATATATCA
CCAGGAATTGGAGAAGTACGAGCAGGCATGCAACGAGTTCACCACGCATG
TCATGAATCTTCTACGCGAACAGAGTCGCACGAGACCCATTACACCAAAG
GAAATCGAGCGAATGGTGCAGATCATCCACAAAAAGTTTAGTTCCATACA
AATGCAGCTGAAGCAGTCGACCTGCGAGGCTGTAATGATACTTCGTTCGC
GTTTCCTGGACGCACGCCGCAAACGCCGCAATTTCAGCAAGCAGGCATCC
GAGATTCTCAACGAGTACTTCTACAGTCACTTGAGCAACCCATATCCATC
CGAAGAGGCCAAAGAGGAGTTGGCACGAAAGTGTGGCATCACGGTCTCGC
AAGTATCGAATTGGTTTGGCAACAAGCGTATTCGCTATAAGAAGAACATT
GGTAAGGCACAGGAGGAGGCCAATTTGTATGCGGCCAAGAAGGCGGCTGG
TGCTTCACCGTATTCCATGGCCGGTCCACCCAGCGGGACAACCACACCCA
TGATGTCACCCGCTCCGCCACAGGATTCCATGGGCTATCCAATGGGCTCC
GGCGGATACGACCAGCAGCAACCGTACGACAACAGCATGGGCGGCTACGA
CCCAAATCTCCATCAGGATCTAAGCCCC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items