CG33936
Fly Line IDF000136
Construct IDP000560
CG/CR NumberCG33936
SymbolCG45050
Gene NameCG33936
Gene SynonymsCG45050; CG33936; anon-EST:fe1B11; anon-EST:fe2G11; drn;
CG33188; BcDNA:RE70963; CG33937; CG33187; CG16750; CG1675
1; CG3393; anon-85Da; CG43674
FBgnFBgn0053936
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGAACGTGAATCTAACCCAATGCAACCCATGTGCCGCTCCGGTTGCGG
CTTCTATGGTAATCCAGCCACAGATGGTCTCTGCTCCGTATGCTATAAGG
ACTCGCTTAGAAAAAAGCAACAGCCACCTGTGAGCAGCACACCTGTCTCC
GTTCCAAGCCCACAACCTAGCCCCACATTCAGTCCGGCCATCGCAATCAC
CAACACCGCACAGCCCACAGTCACCAGTTTACAACAGCCACACAACGATG
TCAAAGAGAAAATCACCGAAGAAGCCGCCGCTGCTGCCAAAGTCAACAGC
GAAGCCATCACATCGGCGACTGGTCCAAACACTTCCACACAAGCAGCCGC
CTCCGCCAACGAGGAGGATGACAAGGACAAGGAAGACGATAAGGATGCCA
AAAAGAAGAAGAACCGATGTGGCGAGTGCCGCAAGAAAGTTGGCCTGACC
GGTTTCCAGTGTCGCTGCGGCGGTCTGTACTGCGCCGTGCATCGTTATTC
TGATAAACATAACTGCACATTCGATTATAGAGAGCATGGCGCACAGGAAA
TCCGACGCAACAATCCGGTTGTCGTTGGCGAGAAGATTCAAAAGATT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items