sisterless A
Fly Line IDF000004
Construct IDP000041
CG/CR NumberCG1641
SymbolsisA
Gene Namesisterless A
Gene Synonymssis-a; sis-A; sis a; sis A; sisa; CG1641; sisA
FBgnFBgn0003411
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGAACGGAGTCATCTTTACTTGCCCACTCTGAGCTACGCGGCCATGGG
TCACGTATACGCACCGTATCGCGGAAGCAGTTCACCCGCACTATCGACAG
CATCGTCAACATCATCGAAGCCGGAGCAGATCGAGGAGCTGGTGTCCCAG
CAGCTGCATCATCTCAAAATGCACTACGCCGACGAGGAGCAACGCTACGT
AGACCAGATGCTCCTGGAGAATCCCATTGTTGTGGAGCGCCGTGCACCGC
CGCCGCTGAAAACGGAGCTTGCTATGGATTGCCGCGGATCGGGTTCCGGA
TCAGGTTCCGGTTCTGGTTCGGATGTCAAGGATGCCCAGCGTCAGAGGGC
CGAGTCGTGCCGCAAATCCCGCTACAACAACAAGATCAAGAAGGCCAAGC
TGCGCTTCCGGCACAAATTCGTCAGCGGGCAGCTGAAGAAGAGCGCCGTC
ATGTTGGACACGATGCGGGATGTGATTGCCCAGGCGGAGAGGCAGCTGCT
CGAGCGGGGATATCCCGCCGCCACACTCGAGCGGATGCGGGCCACTTTCG
GCCTGGAAATGGAGCAG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items