CG11723
Fly Line IDF000082
Construct IDP000078
CG/CR NumberCG11723
SymbolCG11723
Gene NameCG11723
Gene SynonymsCG11723; 11723
FBgnFBgn0031391
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAAATCAGATAACTACCGTCTCATACAGGAGGTGTCCAAGCGGCGGTG
CCTGTGGGACACAAACATGTCCATTTCGTACCGCAACCAGGACGCAGCTC
TCCAGTGGGCGAGTGTCGCGCAGATAATGCAGCAGGATGTCTCGATCTGC
AAGAAACGTTTCAAGGGAATGCGGGACAGCTACCGGGCAGAGGTGCGCAA
GATACAGCAGAAACGAATCGAGATGTCCCACTGGCCATACTTTCGCTCAC
TGGAGTTCATGCGCCAAATCTTCGATCCGGAGGGCCTGGTGCCCTTTCCA
CCAGAGCCCTTCGTGATGAACACCGAGCAGCCGGAAGTCTTCGAGCCCAC
CCGACTGGTTGACTTCGCTATCGATTTGGATTTGGACAATGATGACTCTG
TTGACTTTGAAATCATCGAGGACATATTTAAGCGGGAGCCGTCAGTGCCC
CAGGACTCTGGCTCGGATAAAGGCTCGCTGATCAAGCCTTTGGATTCTTC
ATCCTCGGGCGCCCATCGTTCCGATCAGGATCTATCGCCCACATTGCCCA
TACACTTGCCGCGCCACCAACAATTCCTGCCACGTCCACCCCCGCCTTCG
AAGAGAGGACGTCGGAGGAAAACTTCGCCGTCTAACGATGTCCCCTTATT
GAATGGATACGCCAGCCAGGCGTCAAAGTCTACCACTGAACCCGATCTAA
AGAACGATTCGGACTTGAGTTTCTTGATGAGCATGATGCCGCACGTAAAG
TCTCTGTCAGCCATTAGCAATCTTAAGTTTCGAATGGAGATGGCGCGCGT
TCTGGTGGAACTCAGGGAGGAGGATCAGCACATGCTCGCGGCGGCGGGAC
CCGAAGACGTTCTAGAGCGCAGCATGCCCAAACTAACACCAGCCCCGAAT
TCCAGTTTTGCCACTCAGCTGGAGAAATCCCAGTACCATCTATCCAATTC
CAGCTACCAAATCAGTAGCCGAAAAACACCAACTTCGTTTGACTATGTCG
ACAGCTCCATGGTTGAGTGCGATGTCAAGATAGAGAATGAGCCTCTGCTA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items