CG9797
Fly Line IDF000001
Construct IDP000123
CG/CR NumberCG9797
SymbolM1BP
Gene NameCG9797
Gene SynonymsCG9797; M1BP
FBgnFBgn0037621
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTCGAAATCGGCGCTGAAACACCTAAAGAGCACCTGCCGCGTATGCGC
AAAGTATGCAAGCAACAAGCGGTCGCCGAAGTTATTCGAGCGGAGCAACA
CAAAGATGATCGACAACATTGAGGCGCTCACAGGCCTTCGGCTGGAGAAC
TACGGTTGCCTGCCGGATCAGATATGTGAATGCTGCAGCATGGAACTGGC
CTCCGCCGTTAAGCTGAGGGAGCGCTGCATCGCCGCCCAGCGTGAGCTAC
TCTTGGGATTGACCGAGGAGCAACGCCAAGGCATCTCGGCCTTCTACCGG
GCGGCTGTCATGGGCGAGGATATTGTCCAGACGGTGAAGACGCCCGACGA
TGATGAGGTCTATGCCACTTATCAGGAAATCGTATTGGAAGAACCTAAGG
AAGAGATCGACGACACCAAGGTAGAGTACGATAATACCTACTACGAGGTG
GCCGAGGGACACGCCGGCGAGGACGACGCAGCCTCCTTGATTGAAGAGGC
CGACTATGATTCCATAATGGCCGAAGACGAAGAGCAGCAGCAAACGTTGG
AGCTGGACGAAGACACCGAGCTAATTGTGGGCGACGTCAACGACGCGTAC
GTCTACGATTCGGATGATGAGGTGGCCGTTCTTGACAACGTGCTGGATGA
TGAGTACGAGCATGAAAACATTGTCGTCAAGAAGTGTAGTCTGCCGCCAA
AGCCAAAGGTCCGGTCGGATGATGCGCGTCGTCGTGGCACCGGCGGAGTA
TACATCTGCGAGCAGTGCGGCAATCACATCAAGGGACGCATGGCCTTTGA
ACTTCACTGTCGTCGCCATCGTGGGGACAAGCAATTTGGCTGCGAACTCT
GTCAGTCGCGCTTCTGCACAACTTCCGAGCTGAAACGCCACATGCGCAAG
CACACCGGAGAGCGACCGTTTGCATGTAAGTACTGTGGCCGCTGCTTCAC
AGACTACACCACGCGCGTGAAGCATGAGCGTACCCACACCAATGAGCGCC
CCTACGTCTGTGGTACTTGCGGCAAGGCCTTCACTACCGGCTACATCCTT
AAGAACCATATGCTGATACATTCCGGCGAGCGGGCCTACAGGTGCGAGCT
GTGCGACAAGTCCTTTATGCTGCCCACCCACCTGAGCACCCACTTCCGGT
CTGGCGTACACAAGCGGCATCTGGAGAAAGCCGAGATGAAACAGGTCCTG
GAGCAGGAGCAGAAACGTGAACTCAAGGAGGAGGAGGAGGACAGCCTGCA
CATC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items