CG2712
Fly Line IDF000100
Construct IDP000175
CG/CR NumberCG2712
SymbolCG2712
Gene NameCG2712
Gene SynonymsCG2712; anon-3Be; EG:95B7.7; III
FBgnFBgn0024975
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGACGACCATGTCGCCGCCGTCCCCCATGGACGCCTTGTGCCGCGTGTG
CCACACAGCATCGCCGCGCTGCCTGCCGCTCTTCAAACCGCTCGACGATC
CAATTTCCGGCAAACCAGCGACGCTGGCCAGCATTTTAAGCTACTGCAGC
GGTCTGGAGATCCTAGAGGCGGAGCTCTTCCTGCCCCACCACATCTGCCC
GGACTGCGTGGCCAAGTTGCGGCTCTCGCTGGAATTCAAGCGGAGTGTCC
ATCGCATGGACAGAATTCTGCGGCAGAGTCATGCGGACTTTTGCCGCAGC
AAAAAGATCAGCGCGGTGAATACTAGGGCCAGGCTGTCAACCGAGATTCC
GGAGGATTTTGTACTCGTGCTCGATGACCAGGAAGTGACTGAATATCCAG
CAGAAACGATACGAGATGAGGAGCAACTCCTGGTCGTAGAATCAGATGAG
GCGGAGAGCCGGCTGGAAGCGCCAATTGTACAGGAGGAGAGGCTGGATAT
TGCACTGGAACAGCACGAAGACGATCTCTGCGAGATTGTCGACGATCCGG
ATCCGGAGCAACGTAGGAGCAGGTTAGAAAGATCCGAGCCAGCGCTGCAA
TGTCCCATTTGCGGCAAACAACTGGCTAGGAAGCGGACCTTTCAGTACCA
CATGAGGCTACATGGCCAGCCAAAAATTCGCCAAGAAGACAACGACCACT
GCATTGAAGAGTGCCTCCAAGTGGAGCCCGTTTTGCAGGCCAAAGCTGGC
GAAGATGTCTACGAGATTGTGGAGAAATCAGCACAGACTTCGGCGACGCA
GAAAACTTTGCCCAGTGGAAGCCGGCCTTGGAAACCCCTCAATCCCTCCC
TACAGTGTAAAATCTGTGGCAAGCAACTAAGCACCAACAACTCCTTCAAG
TACCATATGCAGCTACATGGCACGGCCACGCCCTACGTTTGCACAATCTG
CGGAGAGTCCTTTAAGACGCGAAACGCCCGCGACGGCCATGTCACGCTGC
ACGATCGTAACAATCCGAACAGGTGCCCCACCTGCTTCAAGGTCTACCGG
CAGGCGTCCTCGCTGCGCACACACCTTCTAATCCACAGCGGAATCAAGCC
ATTCGAGTGCAGCATCTGCGGCAAGAGGCTAACACAGAAGTCGGGCTACA
AGAAGCACATGCTCACCCACACGGGCGAGAAGCCGCACGGCTGCGACATT
TGCGGCCGTCGCTTCCGCTACTCGAGCAATCTGATTGCCCACAAGCGCTG
CCACAGCCAGGAGAAGCCCCACCCGTGCCCGGTGTGCCAGAAGCGCAGCT
TCGGCAGCACATCCGAGCTCAACCGCCACATGCTCGTCCACAGCAGCGAG
CGACCGTTCGGCTGTGAGCAGTGCGGCAAGTCCTTCAAGCGCCGCATCTC
ACTCGCCATCCATCGCCAGTCGCACAAGGCGGGCAGACAGCGGAGGCGGG
CCGAGCATGAAGTGGGTGTCCAACTGGAGGAGCAGGACGAGAATGTGGAG
ACC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items