unc-4
Fly Line IDF000096
Construct IDP000187
CG/CR NumberCG6269
Symbolunc-4
Gene Nameunc-4
Gene SynonymsCG6269; Dunc-4; DPHD-1; unc-4
FBgnFBgn0024184
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGCCGCTGTGAATGCTAGCAATGCGTTCGCCAATCTAACGGGACTGAG
TGCGGCGGCGCTGCGAAACGTGAGTGCCGCCCAAACGACGGCGGTGGCGG
CCGTCGCCAGTACAGTGGCCACCATCCAGCACCGACTGATGATCGGCAAC
CGGCAGAGTTTGCCGCCGGCGGGACCACCCAGCGAAGGATCTAATGAGGA
TGGCGGTTTTCCCGGCGACGGCGACGACGACAGCAGTGCGGCCAAGCGGC
GCAGGTCGCGCACCAACTTCAACTCCTGGCAACTGGAGGAGCTGGAGAGG
GCCTTCTCCGCCAGCCACTATCCGGACATCTTCATGCGGGAGGCCCTGGC
CATGCGGCTGGACCTCAAGGAGTCGCGAGTTGCGGTATGGTTCCAGAATC
GACGTGCCAAGGTGCGTAAGCGCGAGCACACGAAGAAGGGACCCGGCCGC
CCCGCCCACAACGCCCAGCCGCAGACCTGCAGCGGTGAGCCCATTCCGCC
CAACGAGCTCAAGGCCAAAGAGCGAGCCCGTCGTCGAAAGAAGCTGGCCA
AGGCCATCGACCGGCAGGCCCGGAAACTGCAGGCCAAGGGCATCACCGTG
GACCTGGAGGCCCTCAAGGCCGAGTACATATCACAGCACAAGGCGAACGG
CACCTTCTCCGATTCGGACCTGGAGGACGATGGCATCCAGATCGACGTGG
TGGGCGGCACGGACAGCGACGACGAGGGCGACAGCGACGCCGTCAGTCCG
GTGCGTCTCGGTGGCGGAGGAGGTGGTGGCGGTGGCACTGGAGGCGGCGG
AGGTGGTGGAGCCTCCTCGTCGCTCCACTGCGGACTGGATGGCGATGGCG
ACAGTTCGCGGGCGGGCAGCTTTATCGGCGGCGGCGGTAGCCTGGGCAGC
CCCAGTTCGGTGGCCCCACCCTCGATGCTCTCCAATGGAGCGGTCCAGTT
CGGCAAGCTGGAGCCAATGGATGGCAATGAGTCCGAGGAGCGGGACAGAG
AGCGCGACTCGCCAAAGCCGCTCCTCTTTCCCGCCAAGGCTTTCCATCAA
CTGAACCTGCAGAGCAGCCAACAGCACCACGGTCTGGTGGTGGGCCAGGG
TCAGGGATCGGGATCTGGACACGGGCACGGGCACCAGCACAACCACCATC
AGCACCACCTTCATCATGGCAGTGCATCCGCCTCGGCGGCGGCAGCAGTG
GCCAATCTGGTGCACCAGACATCGCCGATCAGCATGCGCCGGAGCAATCC
CTTCAGCATCGAGTCCTTGCTGTTCAACAACACG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items