AP-2
Fly Line IDF000123
Construct IDP000480
CG/CR NumberCG7807
SymbolTfAP-2
Gene NameAP-2
Gene SynonymsCG7807; dAP-2; dAP-2alpha; DAP-2; AP-2alpha; l(3)1215; AP
-2; TfAP-2; dTfap2
FBgnFBgn0023417
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCACATTCTACACCGCACCAACGACCATCAGTTCGAGGATCAGAAGTT
CATGATGGAACGCCTCAGTGGACATGGGAGTCTAGGGCTGTCCAGCGGCA
GTGCGGCGTACACAACGCATTCCGGCGGCCACACGGGACGCAGCGGACCG
GCCACGGGGCACAGTGGGCACAGCAGCACCCATGGATCGGCGGCCACCAT
GCACCACCAGTCGCTGCAGTCCGACTTCCAGCCGCCGTACTTCCCGCCCC
CCTTCCACCACTCCACCCAGAGTCCTCCCCAGCAACAGAACCATGGAGCC
CTCGAGTACTTGGGCACGGATCCGTATGGCCAGCCCCTCTCCTCGCTTCA
CCACGCCCCACTGCACCACTACAACCAGCTGGCGGGACTGAGATCCACGC
AGGACCAACTGGGGATCCACAGGACCCACAGAGAGGCTGAGCTGCAGGGA
CATGTCACCCAATTGTCACATGGATTTCCGTACACGGATAGGAGGAGCGA
TTACGGCAGTGCAATATCCGCGGGAGCTGCCCACGGAACGAGACTTGGCC
ACGAGCACGAGTCCCTGGCGCTGCACCAAGCCCTTCAAAACGCCGTCGAT
GATGTCCAAGCTCCTGCCCTCGACGACAATGTGGCGTTCATGTCAGACTT
GCCGCTCATAAAGAGCATGAAAAGCGGAAAAGAAGCCGGGAACATTGGAT
CGGGTTCGCCCAGCGAGGTATTCTGTGCAGTTCCTGGTCGCCTCAGTCTC
CTATCGAGCACCTCGAAATACAAGGTCACCATAGCCGAAGTACAGCGTCG
ACTCTCGCCGCCCGAGTGCTTGAACGCCTCCCTGCTGGGCGGAGTGCTCC
GAAGGGCTAAGAGCAAGAACGGAGGTCGCCTGTTGAGGGAGAAGCTGGAA
AAGATCGGCCTCAATCTACCCGCCGGTAGACGGAAAGCGGCCAACGTCAC
CCTACTGACATCCTTGGTTGAGGGGGAGGCAACGCACCTGGCCAAGGACT
TTCACTTCGTTTGCGAAACCGAATTCCCCGCCAGGCAGCTGGCCGAGTAC
ATCGTGCGCCACCAAACGGAGCCGCAGGACTCGTACCGTCGAAAAGAGCT
CATTCTCCACTCCCAGCAGATAACAAAAGAGCTTATGCAGATCCTGAGCC
AAGATCGAACGACCCACTTTGGGACGAGATCACAGCATCTGCTGGAACCA
TCGATGCAGCGCCACTTGACGCACTTCTCCCTGATAACGCACGGATTCGG
ATCGCCCGCGATTATGGCTGTTCTGCACGCTTTTCAGACATTTTTAAACG
AGTCATTAAACTACTTGGAAAAGCTGTACCCTTCGAACGGCGGAGGGATG
GTGTCGTCGTCGTTGGACAAAAGTAAAATTGACAACGAAAAGAAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items