CG10949
Fly Line IDF000040
Construct IDP000102
CG/CR NumberCG10949
SymbolCG10949
Gene NameCG10949
Gene SynonymsFBgn0032858; 38C.46; CG10949
FBgnFBgn0032858
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGACGACGATGAGCTGATTAAATTGATAGAGAGACACCCGATCCTGTA
CGACAAGGACTGCGCGAGGAGCGTGAAGAATGCGGCGCAAAAGGACGCGG
CCTGGAAGGCCATCTCCCAGAAGTTAGGAGCCTCGGAACGGGCGTGCATT
ACGCGCTGGAAGAGCATTCGCGATCGTTTCGGCAAGGAGTTTCGCCGTTT
CCAGGAGCGTCCGGATGAGCCCACCTACTGGGACATGTTTCCGCGACTGC
TCTTTCTCAAGGATCACTACAAACAGGGACTGGCAAGGAACGAGAGTCTC
GACGGGATGCGTTTTGAGCCCAGGGAGCGGAAAAAGCGCACAAAAGTGGA
CATGGAGCAGGAGAGGCGGAGAAAGGACGAGGAGGAGGAGGACTCCCAGG
ATGACCTGCTGAACGAGCAGCTCATTGAGCTGGTCAAGTCTCATCCCGTG
CTGTATGATCGTCACAAGATCAGAGTCTCCAAGAACCTAGCAGCGAAAAA
CGAAGCCTGGCGAGAGATTTCTGAAAACCTAAATGTGTCGGAGGAACTTT
GCTACAACCGCTGGAAGAAGCTGCGTGATCGTTTCGGGCGGGAGTTCCGC
AGTCATCAGATCAACCAGTCCACGCCCATCACGTGGAGGTACTTTAACGA
CCTTCTCTTTCTGGGCCGCCACTTCCGCAAAGGAGTGCCCCTGGTTTTGG
AGAACATCAAGCGACGTGGACGACCACCCAAAGCAGGAAATCCTTCGGGA
AAGACCAGCAAACAGCCGGAGGGAATGGTGATCTCCAGTGGTGAGCAAAT
CTGGGGCGCTGATTACCCCTACAGTACGGACAACGACGATCTGGAGGATG
ATCTTGAGTTGGCCTACGATGAAGAGATTGAGATACTATCGGAGGCGGAG
CAAGCAACGCCGTACGATTTTATCCTCAGCGAAGCGACGGCACGGCAGGA
CTTGGAGCCACCACAGCAGCTCCAGGTGACCACCACCACGCCGGCCACCA
GTGAGGAAATAATTCACACAATCGCCAGGGTAAATCCCGTCGTAGAGGAG
TCCTCCTCTCTCCCTGGGGACTCTGTACCGTCTGCCGCCATCTCCGACAA
ACTGTTGACCACCGTGATTGCCAACATGGAGACCGTGCTTCAGCAATCCC
GGGAGCTGCAGGCCCAGATTCACCACGAACAGGAGCAGGAGCGAGAACAG
CGAAGTACACAGCCTGCCAACAGCCTGCTTGCCAAGGCCCAGATGCTGCT
GGACGGACTGAGTCCGTCTGAGCGGGCAAGTGCCGAGCGTAAGATCGTGC
AGTTCCTGTGCCAGTGCCAAATCAAAGCCCTCGATGGCGAGGAGATCGAG
GATGTGGCACCTTGTCAGGTCATTAAC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items