hermaphrodite
Fly Line IDF000071
Construct IDP000151
CG/CR NumberCG4694
Symbolher
Gene Namehermaphrodite
Gene Synonymsl(2)mat; CG4694; her; FBgn 1185
FBgnFBgn0001185
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTTAGTGCGGATCGGGATTCGGTGGAGGAAGAATATGGATCGTGCTC
GGCCTGGAAATTCCGTTGCAGCGTGGACAGGTGCCCCTACAGGACGAACA
GACCCTACAATCTGGCGCGTCATGAGGAGTCCCACATTGGTATTACGCAG
TCCAAGCTATACGGATGCCCCGTTTGCGTTTACAACACCGACAAGGCGTC
GAACCTGAAGCGGCACGTGTCTATCAAACATCCTGGGTGCAAAAAGCGCC
CTCCGGAAGCGCAGCACAAGGATCGCAATGCCAAGTTGCAGTGCCTGGTG
ATGGGATGCAGATACGAGACAAATCGTCCATACGACCTCAAGCGCCACTT
GATGGTGCACAACAATCCGGAGAAGAGCCACAGGACGTTTAAGTGCTCCC
TTTGCACCTACAGCTCCGACCGAAAGGCCAATCTCAAGCGGCACCACGAG
CTACGCCATTCGGGCATAGAGGAGGCCATTCAAACTGCGGAGGAACTGCG
CCAGGAGATGCTGCTGGAGAAGCAAATGCTGAAGGAACATAAGCTAAAAT
ATCAGATCACAGAGAAACAGGATTTGAAGAATCTAAAGTTGAAGGACCAA
AAGCAGAAGGTGCAAATGCTGAGGGATCAGCAACCGAAACAAAGGCAAAA
GAAAGAACAGTTGCTGGAGGACCAGAGTCCTGTGCTGAATAAGCAGCTGG
AGCACGGAAATATTCCTTTAAAAGAAGCCCTGGTAGGCAGTATGAAATAC
GACGAGGAAAGTTTGGAATTTGTTTACGAGGAACTGCAGGAGGAGGAGCA
GCCGCCCATCATCACCATTAGCAACCCGCAGATTCTCCATGGAGACATCC
GGGATAAGCACGTCATCGCTGTCAACGTTGATGGCCAGTTGCGATGGTTC
CAGTCAATAGATCCACCGCCGGGAGCTCCAACAAAATTGGAGCTGCCCAT
AAAGAGCACTTCAATTTCTGTCCAGCAGCAAATGGACGAATTAGACGATG
AGTTGGCCATGTCCCTTGCCGAAGAAGATCAGCAGGATGAGTTTCTTGTG
CCAATGCTGAGCGGAGAGGAACCAGTTAAAATAAAACAATCATCGCTGAC
CGATCTGGCTTGGAGTTGGAGTACGCCGGATGCTGTACATCACATAAGTC
CCAAAGCGGAACTCAAGAAGGACCTTAAAGCTGGCGATGCAGATACAGAT
TTTCCAGATTGGTGGGATGATGGCAAGTACACAAAGATGCAAAAGAACCA
AACATTTGCAAAGCACTCAAAGAAGCCGTCGCAGGAGAATGTGCAACGCA
TCCTGCGCATCATCTATGACATTTACTACAAACCCTTCAAGGAAGATCGC
AAGCAGTTCGAGGCATTTCAAATTAAGGACTCCTGGCTGTGCGCGACTCG
AATGACTCGCATGCAGATAATCAAGGACATGTACTCTAAACAGGGCACGT
TAAGTCAAACT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items