eagle
Fly Line IDF000041
Construct IDP000079
CG/CR NumberCG7383
Symboleg
Gene Nameeagle
Gene SynonymsNR0A3; T1; egon; eag; EGON; spy; Egon; CG7383; eg; Eg; Eg
l; egl; eagle
FBgnFBgn0000560
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAACCAGCTGTGCAAAGTGTGCGGCGAGCCGGCGGCTGGTTTTCATTT
TGGGGCATTTACATGTGAAGGCTGCAAGTCCTTTTTCGGTCGTACTTACA
ACAACATAGCGGCGATTGCAGGATGTAAGCACAACGGAGATTGCGTGATC
AACAAGAAGAACCGCACGGCCTGCAAGGCGTGCCGCCTGCGCAAGTGCCT
CCTGGTCGGGATGTCCAAGAGTGGCTCCCGCTACGGTCGCCGGTCCAACT
GGTTCAAGATCCATTGTCTGTTGCAGGAGCAGCAGACGACGTCGGGCCTC
GGTGGAGGGAGCTCCGTGGGAAGCGGATCAGGAGGCGGAGTGAGCAGTGC
GAGTCTGGAGCAGCTGGCGCGATTACAGCAGGCCAGTAACCAGGCGCGGC
AAACCTATCAGGACAAGACCAATCCCTGCATCAAGTCAGCCACGGCCACG
ACATCACCCAGAATCGAGGGTGCGGCAGTGGGCACGGGAATCGGTGGCGG
CGCCTCTCCGTCATTCCTGCAAGCGGCAAAGCTCCACCACCAGCGGCAGT
TAAAGCTCGATTCCCGCCTCAGCAACACTCCCAGCGATTCAGGAGCATCT
TCGGCGGGAGATCCCAACGAAGATGGTGTCACCAGCGTCCTCGGTGGCCA
GATCGCAACACCATCATCCACCAACGCCACCAGCCTGCCCAAGCTGGATC
TGCGGCATCCGAACTTTCCGGCCACCTCGGAGCCGGATGCTGATATGCAG
CGGCAGCGCCACCAGGAGCTGCTCGAGATCTTTCGCAGTCACTCGGAGCC
GCTGTACAGTTCATTTGCCCCATTCAGCCACCTGCCACCTGTGCTGCTCG
CCGCCGGAGTTCCACAGCTGCCCATTTTCAAGGATCAGTTTAAGGCTGAG
CTGCTGTTTCCGACGACCAGCAGTCCTGAGCTCGAAGAGCCCATCGATCT
GTCCTTTAGATCCCGAGCAGACCCTGCCAGTCCGATGGCCCACAACTCCA
ATAGTCCGAGTTTAAGTGAGCCTGCTGCGGCGAGCCACTGTTTGGGGGAA
TCGACAAACTTCGTCCGAAAGTCCACGCCCCTTGATCTCACCCTGGTGAG
GTCACAAACGTTGACAGGC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items