Dorsal switch protein 1
Fly Line IDF000072
Construct IDP000121
CG/CR NumberCG12223
SymbolDsp1
Gene NameDorsal switch protein 1
Gene SynonymsDsp1; DSP1; dsp1; CG12223; ssrp2; Ssrp2; Hmg14D
FBgnFBgn0011764
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGAACACTTTCATCAAATACAGCAATTGGCTGCTCAGCAACAACAACA
AGTACAACAGCAACAGTTGCAACAACACCAGGTGGTCGTCCAGCAGAATC
AGCAGCAGGCGCACCAGAACAGCTCCAATACCACAGCCGGCGTGGGCACC
CAACAGCTGTTCACATACAAAATGGCCAGCAGTTTTCCGAATCCGGCCAC
GACGATGGCCCAAGTGGTGGCCACATCGAACGCAGCCGGCACCACGGGCT
ATGATTATCGTCTAAATATGGCACAGGCAGCAGCAGCAGCAGCCGTACCC
GGCTCCCAGTGGTGGTATTCGGCCGCCAATCAGGGACAGGTCGATGCTAA
TACAGCGGCGCAACTGCAGCACCAGCAGCAGCAACAGCAGCAGCAACAAC
AGCAGCAGCAGCAACAGCACCAGCAGCAACAACAGATGCAACAGCAGCAG
CAGCAACAGAATGTCATCAATTCGGCGAGCCCCATGAGCAGAGTCAAGGC
CGATGCCAAGCCCAGAGGCCGAATGACCGCCTACGCATACTTTGTACAAA
CTTGCAGAGAGGAGCACAAAAAGAAGCATCCCGATGAGACGGTGATATTC
GCCGAATTCTCGCGGAAGTGCGCCGAACGGTGGAAGACAATGGTGGACAA
GGAGAAGAAGCGCTTCCACGAAATGGCCGAGAAGGACAAGCAGCGATATG
AGGCGGAAATGCAGAACTATGTGCCGCCCAAGGGAGCGGTTGTGGGACGC
GGCAAGAAGAGGAAACAGATCAAGGACCCCAATGCTCCAAAACGTTCATT
GTCTGCGTTCTTCTGGTTCTGCAATGACGAGAGAAATAAGGTGAAGGCAC
TTAATCCCGAGTTCGGAGTGGGCGACATCGCCAAAGAGCTGGGACGAAAG
TGGTCCGATGTGGATCCCGAGGTCAAGCAGAAGTACGAGTCGATGGCCGA
GCGGGACAAGGCTCGATATGAACGCGAGATGACCGAGTACAAGACGAGCG
GGAAAATAGCCATGTCCGCACCGTCGATGCAGGCGTCGATGCAGGCGCAG
GCACAGAAAGCCGCGTTACTTGCCGCCGCTGCCCAGCAGCAGCACCAGCA
GCTGGAAGAGCAGCACGACGACGACGACGGCGATGGAGATGATGACGAGA
ACCAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items