CG10654
Fly Line IDF000008
Construct IDP000129
CG/CR NumberCG10654
SymbolCG10654
Gene NameCG10654
Gene SynonymsCG10654
FBgnFBgn0036294
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCCAGCAACGATGTTTGATTCCCAGCTGAGTTTGTGCGCGGGTCGCAT
TGTCGCCGATTCCACCACCACCACTACCTCCGGCATGGATGGATGCGATG
GTGCCAAGACGATGATATGCCGCGCTTGTCTTGTGCTACTGGGTCCGCAG
GATGCGTGTCACAATCTGGACAGCGAACAGGATCTGGCCAGCAAGTACTA
CGGCTGTACTGGAGAGGATGCCGTTAGGGATTTGCCACCCCAGTTGGTGC
TGAAAAGCATCTGCGAGTGCTGCTATCAGTTGGTGCAAAAGTTCCACGAC
TTTCAACGCATGTGCGCAGAGTCCTTGCGCAATTTTGAGAAGCTGCTGCA
GGACATCGACATCGGATGCCACAAACTGGAGGACCACACTTGGCACGACT
TGGACACCCCCTCGGAGAGCAACGAGTCCACTAATCCGGAAGCCCAGTCG
CACGCACCCTGCATCGCAGCGACGCAGGAGATTGAGGAAGTCTACGTAAT
AGAGGACGAGTCAGCCAAACAGGATCTGGGCCAGGAGAAGCTATCCATTT
CTAGCAAGTTGCTGGGTGCCAGAAAACGACGAGGAGTGCGACACACCCTC
GAGTGCCGAATTTGCCACCGTGGCTTCTACAAACCGTCGCTGCTGGAGGC
CCATATGCAGCAGCATGAGGGTCTGAGACCGTATACCTGCGTCCATTGTG
CCAAGAGCTATGCCCGGGCCAATCTGCTGGAGTCGCACCTGCGGCAGATG
CATAACAATGCCGACGCTGCGCGGATCATCTATGCCTGTCCGAGCTGCAA
CAAGGTGTACACAGCGAACCGAAGTCTCAAATATCACATGAGAAGGACGC
ACGAAAGGTATCACGAGTCAGAGTCCCCGGATGCGCGGCACATTTGTGAG
GAGTGTGGCAAGTGCTTTGCGCGAAAGGCACATCTAACGCGCCACAAGAT
GGTCCATGGTAGCGTTGAGGGTCGGAGATACTGCTGCGAATGCTGCGATC
GCAGATTCTACACCAAGGAGAACATGGTGGATCATCTGCTGCGCAAGCAC
GGCAATAAGAATCTGCTGCTCAGATGCAGAAAATGCGGACGCATTTTCCA
GAACAGCGTGGAGCTCAACGCTCACGGGAGGAAACACAAAGCGATGGATG
TAGTTCAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items