CG17829
Fly Line IDF000019
Construct IDP000142
CG/CR NumberCG17829
SymbolCG17829
Gene NameCG17829
Gene SynonymsEG:115C2.6; CG17829
FBgnFBgn0025635
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTAAGGCCCCAGTCATCAGTGCCTGCGCCTCAGCCGCCTGGCAAGCG
AAAGAAGCCCGCGGAACTGGAACTGACCTGCGGATGGCGCGACTGCCAGG
AGATCTGCACTGGCGAGTGGAGCCTGAACGGGCATATTGGGGATCATCTG
GAGCACTATGCGAAGGCCCAGGACGATCGGGGGGCGCATGCGGAGCACAC
GGAGCATCAATGCACATGGAACTCCTGCGATTTCCGCACCGAAAACCAGG
TGGAGTTTGAACGGCATTCGTACTACCACGGCTACTACTTGAACCTGCTC
CTGCAGGGGAAGCTGGAGTGCGATCTGCATCCGGAAATCCCCGCCTGCAC
TGCTCCGGCCCGCCTCATGGAGAAGCTGCCCGCTCTGGGCCAGAACTTTC
GATGTGGTTGGACCGACTGTGAGAGGGAGTTCGTTTCGATTGTGGAGTTC
CAGGACCACATCGTTAAGCACGCCCTATTCGAGTACGACATACAGAAGAC
GCCGGAAGACGAGCGGCCCAAGACGATGTGCAACTGGGCCATGTGCCACA
AGCACATGGGCAACAAGTACCGCCTCATCGAGCACATCAGTACCCACTCC
AACAAGAAGCAGGTGGCTTGCTTCCACTGCGGCGAACTGTTCCGCACCAA
GACTACGCTCTTTGATCACCTTAGACGCCAGCCGGAAAACAACACAAACA
GCTTCCAGTGCGCCCAATGCTTCAAGTTCTTTGCCACCAAGAAGCTGCTG
AAGAGCCACGTGGTGCGACACGTTAACTGCTACAAGTGCACCATGTGCGA
CATGACCTGCAGCTCGGCCAGCTCGCTGACCACCCACATTCGGTACCGCC
ACCTCAAGGACAAACCGCTCAAGTGTAGTGAGTGTGACACGCGCTGCGTT
CGGGAGTCGGATCTGGCCAAGCACGTTCAGATTGTCCACTCGAAGACGGT
GCACCAGTGCGAGCATCCCGACTGTCATTATTCTGTACGCACCTACACGC
AGATGCGACGGCACTTCCTCGAGGTGCACGGCAACAATCCCATTCTGTAC
GCCTGCCACTGCTGCGAGCGCTTCTTCAAGAGCGGCAAGTCGCTCTCCGC
TCACCTTATGAAGAAGCACGGCTTCCGCCTGCCTTCGGGCCACAAAAGAT
TCACCTACCGGGTGGACGAGAACGGGTTCTACCGCCTCGAGACGACGCGC
CTCGAGAGCTTGGAGGTGACCCAGCAAATACTGTCGCCGCAGGTGAACGA
CTCGCTAGCGAAACCGGGCACAGGATCCTGCTACGAGATCGTGGATCCCA
CAAATACCGAGTTCGAGCGCATCATCGTCTCGAATGATCCGAACGAGGCG
CAGCTGATGGGTGAAGTGGTAATCTCCCTGCCCAGCCTAGCAGAGGAGCT
G

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items