CG15696
Fly Line IDF000015
Construct IDP000009
CG/CR NumberCG15696
SymbolCG15696
Gene NameCG15696
Gene SynonymsCG15696
FBgnFBgn0038833
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAGTGACTTCAGCATCGAGTATATTTTGAACCGAGCCGGCGACAGATA
CGTGGGCACCAATGCCTCCTTGGGCGTCCTGCAGCGACTCCGTGCCAGCT
TGCCTTTCCATCCGTACGCCCACCCAGCATCTTATGTCTCAAAGGAGTCT
GGAGGATCTCCTCCAGCCTCGGCTGCGGAGGCTCAGATACCCGTCTACGA
TTGGCTGCAGTACACCCGGTACCATCCGCCCAAGTTGCCCAGAGCCCTCC
GCCAAAATGCGCCCGCCAAAAGGACTCCTGGTCGCCTGCCCCGCATCCCA
TTTACTCCGCAGCAGCTGCAGGCCCTGGAAAATGCCTACAAGGAGTCCAA
CTATCTGAGCGCCGAGGACGCCAACAAACTAGCCGACTCCTTGGAGCTGA
CCAATACGCGAGTGAAGATCTGGTTCCAGAATCGTAGGGCTCGCGAGCGA
CGGGAGAAGCGCGAAAAGGACGAGAGTTGCGACTCCACCTTCTCATCGAA
CGCCTCCAGTCCGGAACCGGAAATGATCGTTGTAACG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items