Nuclear factor Y-box A
Fly Line IDF000087
Construct IDP000146
CG/CR NumberCG3891
SymbolNf-YA
Gene NameNuclear factor Y-box A
Gene SynonymsNF-YA; dNF-YA; Nf-YA; CG3891
FBgnFBgn0035993
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGAAAACCATTTCAGCGCCACCAGTCGCCCCTCAGCCACGCCCAGAAT
GTGCACCACCGCCTCTGCCGTCGGTGCTGCCGCCAGCGCCGCCGCCGCCG
CCGGCAACAACAATAACAACAGCAATAGCAGCAGCAACAACAACGCAACA
ACCGGCAACAATTTAAGTGTTAGCACTGCAGCCGGAGGAGCCACAAATGC
CGCAGCAACGGCACAACCCATCCAAGTGATACCAATGCCCATGCTGCCCA
CCGGAGCGGCGCAAATCATAATTGGCCAGCAGCCACAGGGTCAGGCGACG
GCGACGGGTCTGCAGCCACAATTGATACCGCTGCAGGCCAACCAGATTAT
GCTGCAGGCTGCGCAGCAGCAGCCACAGATGCAGGTGATGCAGCTGCCCG
ATGGCCAGACTATATTCTATCAGACGCCCACCATTGCCGCCTTGGATCCG
AATGCAGCGGCCAACGCCGCAGCTGCCATGGCAGCCCAGCCGACGCCGCA
CTACCTCAATATCAATGGGCAGCTGGTGCAGATCAATCCAGCACCGAGCG
CTAATCAGGCGGCACCCACAGCTGGGCAACAGATTATAATGGTGCCGCAG
ACAGCGATGGCAGCGGTGAATGCAGCGGCCGCCAATGCCGGAGTAGGCGC
CGGAGTGGGCACAGTGGTTACCCAACAACAACAGCAGCAGCATCAACAAG
TACAATCCCAGACCCAAAACCAGCAGCAGCAGCAACAGCAGCAGACGGTG
GCGGCGGTGGCTGCCAGTGCTGCAGTCAATAATATAAGCGCCGATGTCAG
CACAAGTACAACTGGAACGAATACGAACAGCGAGGACGAGAGCTCCAAGG
GCGAGGCGGACGAGGAGCCGCTCTATGTGAATGCCAAGCAGTACAAACGT
ATTCTCATTCGGCGGCAGGCCAGGGCCAAGCTAGAGTCGCGCATACCCAA
GGAACGGTGCAAGTATCTGCACGAATCTCGTCATCGCCACGCCATGAATC
GGGCTCGTGGCGAGGGTGGTCGCTTCCATTCGGCACAGGAGAAGGGCGAC
CAAGATTCGTCCGGCCCGGAAGGCGGCAGCATGCCAATGGCGTCCAGTGG
CGGCGTCACCCTCAGCCGTGGCACGGCACGTGCTCCGCCCAAACTGATCG
CGCCACATCAAACGCCCAGCATTACCATAACGGCGATCAAATCGGAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items