CG9705
Fly Line IDF000035
Construct IDP000048
CG/CR NumberCG9705
SymbolCG9705
Gene NameCG9705
Gene SynonymsCG9705
FBgnFBgn0036661
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGACCGAACCAAGGACGCCCGAGAAGCTGCTGGCCGCCAAGCCGCCGGT
TTTACACCACAACAGCCATAGTCCCAATGCCTCGCTGCAGCTGCCCAGTC
CCATCATCACGAGGCGCACTCGCACGGCCTCGACCTCCGCTCGGGCCTTG
GAAAATCCGGTTGTGACCGGTATGGTGAAATCCTTCAGCCGCACCAAAGG
ACACGGCTTCATTACACCCAACGCCGGCGGAGAGGACGTTTTTTGCCACG
TTTCCGACATCGAAGGTGAATATGTGCCCATGCCCGGGGACGAGGTCAAA
TACCGTCTGTGCGCCATTCCGCCCAAGTATGAGAAGCACCAGGCCGTGCA
CGTGCAGATTAGCCACCTGACGCCGGAGGTGCACCACAAGTGGGAGGAGC
CATTCTATGGTGGCTCCTCGCCCGCTAAG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items