CG31365
Fly Line IDF000134
Construct IDP000458
CG/CR NumberCG31365
SymbolCG31365
Gene NameCG31365
Gene SynonymsCG4639; CG31365
FBgnFBgn0051365
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGATGCACAGCCGTCGTATCCCGATTTGGCGACCCTGTGCCGCCTTTG
CCTCAAGGAGCACCAGGATGCGTACGCGATCTTCGACGAGGACGACACCC
AGCTCTCGATACCCGTGCGCCTGATGGCCTGCGTCGCACTGGACGCCAAG
GCGACGGATACTCTGCCGAAGAGGATCTGCCAGGAGTGCCGCTATCAGCT
GGAGAAGTCATTCCTGTTCCGGCAGCGCTGCCAATGGGCGGAGAAGAAGC
TTCGCAAGCATATCCGACTTCTGGGTCTCGGGAAGCGAAGCCGCGTCTTC
TCCAAGGATCCGGACGATTATGACGAGGACGAGCTGGAGTTCGAGGACTC
TATTGCCTTCATCGAGGTGCAGGACAAAGTGCGCAAGCTTGAGGACGAAA
AGTGGCGAGAAGATTTTAAGGAAGAACAGGCGGCGGAAATGCACAAACGG
CTGGTCAAATCTCGTCTAGAACTTCGAGCGAAACTGACCACCGAACTGCG
CAAGGAACTAGCGGAGGAGGTGCGCAGTGAGGTTCGCAAGGAGCTGGCCG
AGGAGGTGCGCAGCCAGGTTAGAGATGACCTGCGAAACGAGGTGAGCGAG
GACATAAGAAAAGAGCAGCTGGCCATGCTGTTGGGCGAATTGGAGGTGTA
TCTTACCGAGAAAAAGGCCGGTCGGTGGGAGTCTTTGGATGGGTCCGAAC
CAGAGACCAAGCCGCAAGTCAAGGAAGATGCCTCCCCTTCTAGGTCAAAA
ACTAAAGCTCTTCCAAAGCGACGACCCAGCTTGGTCGACGCCAATCTAAA
GGCGACAGAGGCCAGGAAGGATGCAAAAGAAGAGGAATTCATATTGGGCT
GCAATACCGACCCCGCAAATAATAGCGATGTAAACATAGATGGCCTCGAA
CTGGACGAGGAAGTGCCCGCGGAAAGCGGTGAAGACTTCAGGGAAATCAA
CATGGTTGGATCAGATGTAGTGCACACAGACAATGGAGAGATTTACATCA
TAAACTCTGCCAGCTCAGAGGATCAAAACCAGGACTCCACTCCCGAATTT
GACCAGGACAACGGAATCACCTCCTATAACATCAAAGAAGACGGCGAAAT
TCAGTTCAGTGGCGAAAAGCCAGAGGAAATCGAAGACGTGGTCGTGTTTA
ATCTGGGCGAGGAGATATCTCAGGAGCAACAGGTCTTCAGCTTCCATGAA
AATGTCATTATAGTGGAAAAAGAACAGAACGATAGAGATGAGCAGACGCC
CCTCAAACGAAAGAGATCGAGTGAGTTGGTGTTCAAGCAGGAGTCCAGTT
GTCCTCAACCAAAAACCGGTCGAATTACGGACACGGTGAAGTCGTTCCAG
TGCCATTTGTGCCCGGTGGCATTTCCTACGCAGAAACTTCTGACGCGCCA
CCACAACACCCACATTAAGGGACTGAAAAGTGGAAAGGGCGGCACGCTCA
AGTGTCCCAGCTGCGCACTGCAACTGTCGTGCGCCAGCTCGCTCAAACGC
CACATGATTATCCACACGGGCCTGAAACCCTTCAAGTGCAGCGAGTGCGA
ACTGTCCTTCTCCCAGCGCGAAGTGCTCAAGCGTCACATGGACACCCATA
CGGGAGTAAAGCGCCATCAGTGCCCCCAATGCTCGAGCTGCTTTGCCCAG
AAGTCCAACCTGCAGCAGCACATTGGCCGCGTGCATATGGGCAACTCTCG
GACGCACAAGTGTCATCTGTGTCATCGTAGCTTCAATCATGTTTCGGGCC
TCAGTCGCCATCTGGTCACCCACGCTGGCGTCATGTTCTCCTGCAAACAG
TGCGGCCGTCAGTTTAACGATCGCAGTGCGGTCCAGAGACATGTAACCAC
AATGCACAAGGTGAAGAACAAGCTCACAGACTACATATCCGAGACGAACG
AGTTTCAAGCTGTGGCC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items