Ecdysone-inducible gene L3
Fly Line IDF002924
Construct IDP005804
CG/CR NumberCG10160
SymbolImpL3
Gene NameEcdysone-inducible gene L3
Gene SynonymsLDH; CG10160; dmLDH; IMP-L3; Imp-L3; Ldh; ImpL3; Impl3; L
d; dLdha; IMPL3; dLDH; impl3
FBgnFBgn0001258
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGCCGCCATTAAGGACAGTCTGTTGGCCCAGGTTGCTGAGGTCCTGCC
CAGCTCCGGGCACAAGGTCACCATTGTGGGCATCGGCCAGGTGGGCATGG
CCAGCGCCTTCAGCATCCTGGCTCAGAACGTCTCCAAGGAGGTGTGCCTC
ATCGATGTCTGCGCGGACAAGCTGCAGGGCGAGCTGATGGATCTGCAGCA
CGGCTCCAACTTTCTGAAGAACCCCCAGATCACGGCCAGCACCGACTTTG
CCGCCTCGGCCAACTCCCGTCTGTGCATCGTGACCGCCGGAGTGCGCCAA
AAGGAGGGCGAGTCCCGCCTGTCCCTCGTGCAGCGCAACACCGACATCCT
CAAGAACATCATCCCCAAGCTGGTAGAGTACAGTCCCGATACCATTTTGC
TTATGGTGTCCAATCCCGTGGACATCATGACCTACGTGGCCTGGAAGCTG
TCCGGTCTGCCCAAGAACCGCGTGATCGGCAGCGGCACCAACTTGGACTC
GTCCCGCTTCCGCTTCCTGATGTCGCAGCGCCTGGGCGTGGCACCCACCT
CCTGCCACGGCTGGATCATCGGTGAGCACGGCGACAGCTCCGTGCCCGTT
TGGTCTGGAGTGAACATTGCCGGCGTGCGTTTGCGCGAGCTGAACCCCAT
TCTGGGCACCGGCGAGGATCCAGAGAAGTGGAACGAGCTGCACAAGCAGG
TGGTGGACTCCGCCTACGAGGTGATCAAGCTAAAGGGATACACCTCCTGG
GCCATTGGCCTGAGCACCGCCTCCCTGGCCTCGGCCATCTTGCGCAACAC
GAGCAGCGTGGCCGCCGTCTCCACCTCCGTTTTGGGCGAACATGGCATTG
ACAAGGATGTGTTCCTCTCGCTGCCCTGCGTTCTCAATGCCAACGGTGTG
ACATCCGTGGTCAAGCAGATCCTGACTCCCACCGAAGTTGAACAACTGCA
GAAGTCCGCCAACATCATGTCCGATGTCCAGGCTGGTCTGAAGTTC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items