CG10267
Fly Line IDF000904
Construct IDP000161
CG/CR NumberCG10267
SymbolZif
Gene NameCG10267
Gene Synonymsanon-WO0118547.391; CG10267; Zif
FBgnFBgn0037446
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCGCGTCGAGCTTACCCCACAGACGTGCCGGGTCTGCCTGGCGCAGAG
TGAGCGACTGCAGCGCCTAGACGAGATCCGCGAGGAAGGCGAGGAATCGC
CGAACGAGATGTTGATTCAACTTTTGGGAGTCTCATACAGCAATCTGAAC
GACAGAGAACACATACCCGATGGCATCTGCAAGTCCTGCAAGGTCGAACT
CAACATGGCCTACCAGTTTCGCGAGAAGGCGCTGCGCAAGCAGATGGAGA
TTGAGGAGTACTGCCGGGAACTGGGCTTGCTGGACGAATCAGATGTGATG
ATGATCAAGGAGGAGGACGGCTCGCAGCAGCAATGCGACGAGGAGATGTA
CATCCTGGAGGAGACCACCACCGGGGAAGAGGAGCACCAGGAAGAAAAGG
GGCACGAGGAGTACTTGGAAGTGGACACCAGCGATCAGCAGGAGTGCATT
GGCGACACCATCGAGTACTTGGAGGACAACTACACCATCGAGATGAACTC
CGATCAGACCGAGATCGTCCTGGAGTCTGAGAAGCAGTACGAAGAGACAC
CATCGCAGCAGTTGGCGCTGCAGGAGGCGGCCAAGGCAAGCCTGAAGGCG
CGGCGCGGCCGGGTTCGTCGCGGATTAAACTCCCTAACAACATCGGACGG
CACTGAGAAGGGTGGCTATATCTGCGACGTCTGCGGAAACTTTTACGAAA
AGCGCGGCCGGATGATGGAGCATCGCAGACGCCATGACGGCATCTGCCAA
TATGCATGCGAACTATGCGATGCCAAGTTCCAGGTGCGCGAGCAACTGAG
GAAGCACATGTACTCCCACACGGGCAGCAAACCCTATAAGTGCAGCTTCT
GCAGTCGTCAATTCTTCTACGAAAGTGTTCTCAAGTCTCATGAAAATGTT
CACCGTGGCATCAAGCCCTACGTGTGCAAGGTGTGCGACAAAGCGTTTGC
CTACGCTCACTCCCTGACCAAGCACGAGCTCATCCACTCGGACATCAAAC
TGTACCGCTGCGATTATTGCAACAAGGACTTCCGTCTGCTGCATCACATG
CGCCAGCACGAGGAGACCAAACTGCACCAGAACGCCGTAATGCTGGCCGA
GAGCATGAAGGTGGAAATGGTGGCCGAGCAGGGGGGCGGGAACGAGATCC
GAATTCAAGCTCAC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items