D19A
Fly Line IDF001874
Construct IDP003191
CG/CR NumberCG10269
SymbolD19A
Gene NameD19A
Gene SynonymsCG10269; D19A; d19a
FBgnFBgn0022935
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAACGAGGGCAGGCAGTACTCGATCCACAGCCTGTGCAGGATCTGTCT
GAACCACCTGCAGAACGACGCCGCCTACGATTTGTATCTGGTTCCAGGAC
TTTCGAAGAAGCTATGCTTCTGCACATCCCTGTCCGTGGAGCAAAACGAC
GGATTCCCGAAGAACCTGTGCACCCTGTGCTACACCAAGCTGAACGAGCT
GCACGACTTTCAGAAACAGTGCGTCGATTCCGTGCAAAAGTTCCAGGATC
TGGTGGCCAGCAATGTCTTTGCCTGCCAGAGCAGCTTCGACGTCTTCGAT
CCCAACGTTGCCGTGCAGGACTACCCGGCCGAGGAAGAGGACCACGTCAA
CTATGACCCGCTGCTGAACCACAAGATGGAGCTAATCGAGAACGAGGAGG
ATGTCTTCAAGATGCTGGAGCACGTCGACAAGGAGGCCGAGGAGGTGGAG
AAGGAGGCCAAGGTGGAGGAGGATGACGGGGGCAACGTTTCCGTCAAGAT
GTTCGACGACGATTCGTCCATCGAGAGCGGCAATGACAACGACCACGATC
TGGACTTCGAGCCAAATAGCAGCGATGATGACATTCCGCTGGCCCAGCGC
ATGAGGGGACCAGCTACCGGATCAGGACCCCAGCAGGACCGTTTTAGCAA
CCTAGACAAACCCAAGCCGAGGCCCCGGGGACGGCCCAAAAAGATAAAAC
CGCCTCCGCCAGAGGAGGAGGAGTTGAGCGACTCATCCTCCGAATCAGAT
GACTCCGAAGACGGCACATCGCGGGGCGACAAGCCGAAGAGGAAGCGCAT
TCCCATCGAGGAACGCCACCTGCACCGCATCATCGACTGCCACATTTGCC
ACCAGAAGTTCAAGAAGGCCATCCGCTACGAGGAGCACATGAAGTACCAC
AACGACCTGCTGCCCTTCCAATGCAAGGTGGAGACCTGCAAGAAAGGTTT
CACTACCGCCAATGGGCTGCGCATTCACATCGACCACGCCCACACAGAGC
TGTCCGAGGTTCACGCCTGCATCGCCGAGGGCTGCGGCAAGACCTTCCCG
CGCGTCCGTCTGCTCACCTTCCACATGAAGAAGGTGCACGGTATCACCAA
GGCGGCTGCCCCGCTTCGAGATTTCCCCTGCACAGAATGCGACACCGTAT
TCCGCTGCCCCACAGCACTCAAGAAGCACATGTATAAGCACACGGGCGAG
GAGCTTCCGTATCCTTGCAATATCTGCGGCAAGCGTTTTGTAATCAATAG
TGCTTTAAGGGATCACCTTATGCGTCACGCAGGCATCAAGAACCATGTGT
GTCCGTACTGCGGGGTGGGCAAGACGACGCGCCAGGAATGGAACGCCCAC
ATCCTCACGCACACCAAGGAGAAAAAGTTCAAGTGCCGACAGTGCGACCA
TGCCTCGCACAACAAACAGGCGTTGTCCAATCATGTAAAGGTGGTGCACG
AAAAGCGCAAGGACTTTGCCTGCCAGTACTGCGGAAAGACCTTCGGCAAG
TCGCACGCCTGCAAGGTGCACGAGAGGAGTCACACGGGGGAGAAGTGCTG
CGAGTGCAAGATCTGCGGCAAGATATTCCTCTGCGAGAAGAGCCTCACCA
AGCATTTGAAGACGCACGAGAAAAGGGATCTGCCGCCGGCGGAGCCCCTT
CGCCAGCAGCTTAACATTCCCATGCCCGGCCAAATGTCCGTACCGATGCC
GGGCCAGATGCCGATGCAGATGCAGACGGATGGTTTGGTGCCAATGGACC
CCAACCAGATGCCTAGTGAGGACATGCTGAAGGCATGCGGCGGCGGGACC
GCTGCAGTGCCTCCCAAACCGAAGAACTCGCGACGCGTCCAGCGGGTGGA
CATTTCTCAGCTGGCGGGTACTGCGGTAAATCCAATACCATCCGTATCCG
TGCCCTCGTGGTCGCCGCAAGTGAACTTCACCAAGAAGGAAGGCCAGCAC
ATCTGTCCAGGCTGTGGGCGTGGCTTCAATAATATTGGAAACATGAAACT
TCACTACAAAATCATCCACGAGAAGGTCAAGGACTTTGCCTGTCGCTTCT
GCCCGAAGAGATTCTCCAAGGCACAGATTCTGCGGCATCACGAATGGATC
CACACGGGCGAGAAGCCCTTCGAGTGCAAGATTTGTGGCAAACACTTCCG
CCAGGAGACGGCACTCAAGAAACACATCAAGACGCACGAGAAGCCGAACC
GGAGACACGTGCCCGAGCGCAGTGCGCCCACTCAGATCACGTTCCGCAAG
CTGGAGCCAGACGCCGAGCCGCGTAACTTTGACCAGTATCAGGATCCGGC
GGTGGAGCGGGCAGCGGCCACCGCTGAGCTGCTGGCGCACCAGCTGGAGG
AGAACGAGGCCAAGCGGAAGGCGGAAATTGAGCGGCAGAAGATCGCGGCG
GCGGCCTGCGAGCAGCTGACGAAGCTGCAGCAGCAGCAGGAGATCATCAA
GGCGACCACCTCGTACGATGGCTACTATGCGCAGAAAGCGCAATCCGAGG
GCACCAGCCTGGATGCCCTGAAGATCGACCACGTC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items