CG2808
Fly Line IDF004839
Construct IDP003169
CG/CR NumberCG10017
SymbolCG34340
Gene NameCG2808
Gene SynonymsCG34340; CG10017; CG2808
FBgnFBgn0085369
TypeORF-VN
Plasmidin vivo tag swap
Sequence

ATGTTTTGCTACCAGTGCCCCCCAGCCCTCCATCCATGCGGCCCCCACCC
GCCGCGCCTGCCCACCCTCGACTACCCGTTCGCCGCCACCCATCCATATA
CCAGCTACTCGTATCATCCTGCCATACACGATGAGACTTTTGTCCGGCGG
AAGCAGCGTCGAAATCGCACCACCTTCACACTGCAACAGCTGGAGGAGCT
GGAGACGGCCTTTGCCCAGACCCACTATCCGGATGTATTTACTCGCGAGG
ATCTGGCCATGAAAATCAACCTGACCGAAGCACGGGTTCAGGTCTGGTTC
CAGAACCGCAGGGCCAAGTGGCGCAAGGCGGAGCGCCTCAAGGACGAGCA
GCGGAAGCGGGAAAATGGAGAGAGCAGCAGCTCCCTGGATAAGCTGCACG
ACTCCCGTGAATCCTCGCCAGACATAACGGGTGAAATAGACGATGACATG
GATGACTTGCCGCCTCGTCAGAGGTCGCACAGTCCGCTGGCCAACGGACA
AATGGAGCAGCAGCACTCGCACTCGCATTCCCACTCCCATTCCCGCAGTC
CTGGCGGCGGCATGCACCTGGACTCCAGCGACAACGAGCGCCCGTTGTCC
TCCAACCAGTTGACCGCCACTCCGCACTCTGCCTCCCAGTCGCTGGGCTC
CATCAGTGCCGGATCCCCCTCCCCATCGGGCATGCACAGGGAACGGGAGC
ACACACCTCTGGTCGGAGGCGGTGGTCAGGGACCGAGCAGCCCCTCAAAC
TCGCGGAACACCGACTCCCCCATCGAGGTGGGCGGACCAATGTCCCTGAC
TACGGGCTCCAGGATGGCGGCCTCCTCCAACAATTCGGCCTCATCCACGC
CCACGCCCACCACCCCACATGCCCCCCAGATGCCGCACTCTTCGGCGGCT
GCGGCTGCCGCTTTTGGAAGCCACATCTTTGGCAACTTTGGAGGTGGCAG
CAATGCCAGCGATAGCAACTGCGGCTTTCGTCCCGTTCTGAGTGAGCAGA
GCGCCGTGGCAGCTGCGGCGGCGGCAGCAGCGGCCCAGCGGAGCGCCAAC
CACCCACCGCTTTTCCTGCCACCCCACTTGGCCGCCCAGTTTACCCATCA
GCCGCTTTTCCCGGGCCTGAAAGGCGTCTCTCCATTCCAGAGCCTGTGCT
CATGCTGCTCCCTGAAGCCCCCGCCGCCACCGGGCTCATCGGTGGTGGCT
CCACTGAGCATTCCGGTCAGCAGCAGCTCGGCGGCCAGTTCGCCGGAATC
GCCAAAGTCCTCCGGCCAGGGATCCGTTCATGATCCGCGGTCCAATTCGG
TGGCCGAACTGCGGCGGAAGGCGCAGGAGCATTCGGCGGCACTTTTGCAA
TCGCTGCACGCGGCAGCTGCTGCAGGCTTGGCTTTTCCGGGCCTCCACTT
GCCACCCCTGTCCTTCGCCCACCATCCGGCCTTGGGGCAGCATGTGGTCA
ATCACAACAATAACAACACGATGAGAATGAAGCACGAGGCTCAGGACATG
ACCATGAATGGTCTGGGCCCCGGCTCAGGATCTGGTTCGGGATCAGGTTC
GGCAGGAGGCGGCACATCATCGGCCGCTCTTTTGGATCTGGCCGAATCGG
CAGTTGCATATCAGCAGCAGCAACATGCCACATTGTCGCCACCAACCACG
CCCACGCAGCAATCATCCGGGGGCGTGGCAGCAACGGAGGGCTCTCCAGG
ATCAGGAGCGATTGCAGGATCGGGTTCATTGAATGGAAACGTGGTGCTGA
CCAAAATGGAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items