Zinc/iron regulated transporter-related protein 71B
Fly Line IDF003779
Construct IDP007604
CG/CR NumberCG10006
SymbolZip71B
Gene NameZinc/iron regulated transporter-related protein 71B
Gene SynonymsdZip71B; Zip71B; cg10006; CG10006
FBgnFBgn0036461
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGCCCAAAAGCAGGTGCTAGTCTTAAACCTATTTTGCCTGGGCTCACT
ATTTTTCAAAACAGTGCCAGCTTCCACGGAATACAACAAATACGTGGCGC
AGATATTTCAAAAATACGGCAACGGCGGGACAATCAACTTTGAGGGTCTT
GAGCATTTGATGTTCAGCCTGAACTTGGGTCAAATCCAATTCGATCCCTC
GCACACGATCGATCAGCATCGACCTCAGGGATACTCGAACGAGATGCCGC
ATGCCACAAATGTAACGTATTACTTTGAGCCGACACGAGTCAATGCCACC
GATGAGGAAGCTTTGGAGCTGCAAATCTCTCCTCGTGGCAATCACTCAAA
TTCACAGTCGGAGGCCGAGGTTCCGGAGTTCCTAGAAATTCATGACCCCA
AGCACCGACATCCGAGGGAGAGTTCTGAACCTGTTGCCGCTTGCTTATCA
CCGAAGTCTTTACTTTCCCTCATCGTGAACCACAACGATCTCCACAAAAA
CATTGCCTACCGCAAGCTGCTCATTAAGAATGACGTTAGCTCAACTGATG
GCGTCCACAATTCTGAAGAGGAATACAACGAATTCATCAACTCGGTGCGG
ATCACTCCGCGAGCTTTTATGAAACTCTGTCCAGCTCTATTAGCCCAGAT
CGATAATGGAGTTTGCAAGCAACCAGCTGTACGATCAGTAAACCTTAACG
ATAAGAACCAGAAGATATGGTACGCTTGGATCTATGCCAGCATCACTATG
CTTATACTGTCCGCTTGCGGATTGCTGGGCATTCTTCTGGTTCCTTTGAT
GAAGTCGGCTGCCTATCAGGAAATTCTCAAGTTCCTAGTTTCCATCGCTG
TGGGCACTTTAGCTGGCGATGCCCTGATGCACTTGCTCCCCCATGCCCTT
TTCAAGGAGGAAAAGCACGAGGAGGAAGTCACTGGTATCAATCCCTTGGA
ATCTGATCACAAACATAGCAATGAGGCGGCTCTGCTATGTGGTTGTACTT
TCCTGGCTGCTCTATTCATGTATATGCTGGAGAACCTGATTCCGCTGCTA
AAGGGCGGTAAGCCGGGTCATGGACATAGCCACGGACATGGTCACAGCCA
CGGCCGCAGTCATGGACATATGGAGAAGCCAGCTGCAAAGGATGCTATTG
ATCTGCCACCTCCTCGAGAGCTCAATGTGATGTTGCAGGAGGCCAAGCTG
GATGAGAAGACCCCCGATCGACCGCTCACCCCAGTAGCCTTCATGGTAAT
CATCGGAGATGGCTTGCACAATCTGACCGATGGTCTGGCCATAGGTGCAG
CCTTCGCAAGTGATCCGGTCACTGGATTTGCTACCGCCTTTGCCGTTCTC
TGCCATGAGTTGCCACACGAACTGGGCGACTTTGCTCTGTTGCTGCAAAC
AGGTGTCTCCATGCGAAGAGCCGTCTATATGAACATTGTTAGCTCAGTTC
TTAGCTTTGTGGGCATGTCGGTGGGTCTCTTTATTGCTGGAATTGGAGAC
GGCATGACCCAATGGATTTATGCAGCCACCGCTGGTTCCTTCCTGTATAT
TGCTTTTGCCGATCTGGTGCCCACAATGAGTGTGGCCCACAATCCGGAAA
AGGCCAAAGATCCAAAGGGTATAATAATACAAATTTTTGGTATCCTTCTG
GGTGGACTGATAATGTTGGCTATTGCCCTCAATGAACACGATTTAGAGGG
CCTGTTCAAGAGCTTT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items