sugarless
Fly Line IDF001141
Construct IDP002678
CG/CR NumberCG10072
Symbolsgl
Gene Namesugarless
Gene Synonyms
FBgnFBgn0261445
TypeORF-3xHA
PlasmidpUASg-HA.attB
Sequence

ATGAAGGTCTGCTGCATTGGCGCTGGTTATGTCGGCGGTCCGACCTGCGC
GGTTATGGCGCTCAAATGCCCCGATATCGTGATAACTCTGGTGGACAAGA
GCTCCGAGCGGATTGCCCAGTGGAATTCGGATAAGTTGCCCATTTACGAG
CCCGGCTTGGATGAGGTGGTGAAGAAGTGCCGCAATGTGAACCTCTTCTT
CTCAACGGACATCGAGACGGCCATCAAGGAGGCGGACCTCATCTTCATCT
CGGTGAACACGCCCACAAAAACCTGCGGCAATGGCAAGGGCCGAGCGGCG
GACCTCAAGTACGTGGAGAGCGCAGCGCGGATGATCGCCGAGATCGCGCA
GTCCAACAAGATTGTGGTGGAGAAGAGCACGGTGCCCGTGCGGGCGGCGG
AGAGCATCATGCACATACTGCGAGCGAACCAGAAGCCGGGCATCCACTAC
GACATACTGTCCAATCCCGAGTTCCTCGCCGAGGGCACCGCCATCAATGA
CCTGCTAAATGCGGATCGTGTGCTGATCGGCGGCGAGGAGACGCCCGAGG
GCCACCAGGCGGTGGAGAAGCTGTCGTGGATCTACGAGCACTGGATACCC
AAGCAGAACATACTCACGACGAACACGTGGAGCAGCGAGCTGTCTAAGCT
GGCGGCCAACGCATTCCTCGCCCAGCGAATCTCCAGCATCAATTCGCTGT
CGGCAGTGTGCGAGGCCACGGGCGCAGATGTTTCCGAGGTGGCGAGGGCC
GTGGGTCTAGACTCTCGCATCGGTTCCAAGTTCCTGCAGGCGTCGGTGGG
CTTCGGCGGCAGTTGCTTTCAGAAGGACATCCTCAATCTGATTTACATCT
GCGAGAACCTCAATCTGCCCGAGGTGGCCGCCTACTGGCAGCAGGTGATC
GACATGAATGAGTACCAGAAGCGTCGATTCTCGCAGAAAATCATCGAGAG
TCTGTTCAACACGGTGTCGGACAAGCGGATAGCGATCCTGGGCTTTGCCT
TCAAGAAGAATACGGGCGATACGCGCGAAACAGCCGCCATTACCGTGTGC
CAAACTCTGCTGGAGGAGGGCGCCGCGCTGGATATCTACGATCCGAAGGT
GGAACCCGAGCAGATCATCGATGACCTCACGCATCCCAGTGTCACGGAAT
CGCCGGAGAAGGTGAAGAAGGCGGTGCAGATCCACAGTGATCCGTACAGC
GCAGTGCGTGCCACACATGCGTTGGTCATCTGCACGGAGTGGGATGAGTT
TGTTGATCTGGACTTTAAGCGCATATACCAATCGATGATGAAGCCAGCCT
ACATCTTCGACGGCCGCAAGATTCTCGACCACGAGCGCCTGCAGCAGATC
GGCTTCCACGTCCAGACCATCGGCAAGAAGTACCAGCGCACCGGACTGCT
CCGCTCGTGGGGCATTGTGCCGCAGCTT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items