Epidermal growth factor receptor
Fly Line IDF003563
Construct IDP007124
CG/CR NumberCG10079
SymbolEgfr
Gene NameEpidermal growth factor receptor
Gene SynonymsEgfr; egfr; Elp-B1; EGFR; DER; dEGFR; flb; der; d-egf-r;
top; torpedo/egfr; EgfR; CG10079; EGF-R; DER/EGFR; Der; D
-EGFR; dEGFR1; Egf-r; Elp; l(2)09261; Egf; EK2-6; c-erbB;
DER/torpedo; unnamed; DmHD-33; Elp-B1RB1; Elp-1; DER flb
; top/DER; Torpedo/Egfr; D-Egf; Degfr; Torpedo/DER; torpe
do/Egfr; EGFr; DER/top; l(2)05351; top/flb; l(2)57DEFa; l
(2)57Ea; l(2)57EFa; HD-33; El; C-erb; EFG-R; degfr; EC2-4
; DEGFR; EGfr; dEgfr; DER1; TOP; mor1; dEGFr; DEgfr; Tor;
Flb
FBgnFBgn0003731
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTGCTGCGACGGCGCAACGGCCCCTGCCCCTTCCCCCTGCTGCTCCT
GCTCCTGGCCCACTGCATTTGCATTTGGCCCGCGTCGGCGGCCCGCGATC
GCTACGCCCGCCAGAACAATCGCCAGCGCCATCAGGATATAGATCGCGAT
CGGGATCGAGATCGATTCCTATACCGCAGCAGTTCGGCCCAAAATCGACA
GAGGGGCGGGGCCAACTTCGCCCTGGGACTGGGAGCCAACGGAGTCACCA
TTCCCACCAGTCTGGAGGATAAGAACAAGAACGAGTTCGTCAAGGGGAAA
ATCTGCATCGGCACTAAATCTCGGCTCTCCGTGCCCTCCAACAAGGAACA
TCATTACCGGAACCTCAGAGATCGGTACACGAACTGTACGTATGTGGATG
GCAACCTGGAGCTGACCTGGCTGCCCAACGAGAATTTGGACCTCAGCTTC
CTGGACAACATACGGGAGGTCACCGGCTATATTCTGATCAGTCATGTGGA
CGTTAAGAAAGTGGTATTTCCCAAACTACAAATCATTCGCGGACGCACGC
TGTTCAGCTTATCCGTGGAGGAGGAGAAGTATGCCTTGTTCGTCACTTAT
TCCAAAATGTACACGCTGGAGATTCCCGATCTACGCGATGTCTTAAATGG
CCAAGTGGGCTTCCACAACAACTACAATCTCTGCCACATGCGAACGATCC
AGTGGTCGGAGATTGTATCCAACGGCACGGATGCATACTACAACTACGAC
TTTACTGCTCCGGAGCGCGAGTGTCCCAAGTGCCACGAGAGCTGCACGCA
CGGATGTTGGGGCGAGGGTCCCAAGAATTGCCAGAAGTTCAGCAAGCTCA
CCTGCTCGCCACAGTGTGCCGGAGGTCGTTGCTATGGACCAAAGCCGCGG
GAGTGTTGTCACCTCTTCTGCGCCGGAGGATGCACTGGTCCCACGCAAAA
GGATTGCATCGCCTGCAAGAACTTCTTCGACGAGGGCGTATGCAAGGAGG
AATGCCCGCCCATGCGCAAGTACAATCCCACCACCTATGTTCTTGAAACG
AATCCTGAGGGAAAGTATGCCTATGGTGCCACCTGCGTCAAGGAGTGTCC
CGGTCATCTGTTGCGTGATAATGGCGCCTGCGTGCGCAGCTGTCCCCAGG
ACAAGATGGACAAGGGGGGCGAGTGTGTGCCCTGCAATGGACCGTGCCCC
AAAACCTGCCCGGGCGTTACTGTCCTGCATGCCGGCAACATTGACTCGTT
CCGGAATTGTACGGTGATCGATGGCAACATTCGCATTTTGGATCAGACCT
TCTCGGGCTTCCAGGATGTCTATGCCAACTACACGATGGGACCACGATAC
ATACCGCTGGATCCCGAGCGACTGGAGGTGTTCTCCACGGTGAAGGAGAT
CACCGGGTATCTGAATATCGAGGGAACCCACCCGCAGTTCCGGAATCTGT
CGTACTTCCGCAATCTGGAAACAATTCATGGCCGCCAGCTGATGGAGAGC
ATGTTTGCCGCTTTGGCGATCGTTAAGTCATCCCTGTACAGCCTGGAGAT
GCGCAATCTGAAGCAGATTAGTTCCGGCAGTGTGGTCATCCAGCATAATA
GAGACCTCTGCTACGTAAGCAATATCCGTTGGCCGGCCATTCAGAAGGAG
CCCGAACAGAAGGTGTGGGTCAACGAGAATCTCAGGGCGGATCTATGCGA
GAAAAATGGAACCATTTGCTCGGATCAGTGCAACGAGGACGGCTGCTGGG
GAGCTGGCACGGATCAGTGCCTTACCTGCAAGAACTTCAATTTCAATGGC
ACCTGCATCGCCGACTGTGGTTATATATCCAATGCCTACAAGTTTGACAA
TAGAACGTGCAAGATATGCCATCCAGAGTGCCGGACTTGCAATGGAGCTG
GAGCAGATCACTGCCAGGAGTGCGTCCATGTGAGGGACGGTCAGCACTGT
GTGTCCGAGTGCCCGAAGAACAAGTACAACGATCGTGGTGTCTGCCGAGA
GTGCCACGCCACCTGCGATGGATGCACTGGGCCCAAGGACACCATCGGCA
TTGGAGCGTGTACAACGTGCAATTTGGCCATTATCAACAATGACGCCACA
GTAAAACGCTGCCTGCTGAAGGACGACAAGTGCCCCGATGGGTACTTCTG
GGAGTATGTGCATCCACAAGAGCAGGGATCGCTAAAGCCATTGGCCGGCA
GAGCAGTTTGCCGAAAGTGCCATCCCCTTTGCGAGCTGTGCACCAACTAC
GGATACCATGAACAGGTGTGCTCCAAGTGCACCCACTACAAGCGACGAGA
GCAGTGCGAGACCGAGTGTCCGGCCGATCACTACACGGATGAGGAGCAGC
GCGAGTGCTTCCAGTGCCACCCAGAATGCAACGGTTGCACTGGTCCGGGT
GCCGACGATTGCAAGTCTTGTCGCAACTTCAAGTTGTTCGACGCGAATGA
GACGGGTCCCTATGTGAACTCCACGATGTTCAATTGCACCTCGAAGTGTC
CCTTGGAGATGCGACATGTGAACTATCAGTACACGGCCATTGGACCCTAC
TGTGCAGCTAGTCCGCCGAGGAGCAGCAAGATAACTGCCAATCTGGATGT
GAACATGATCTTCATTATCACTGGTGCTGTTCTGGTGCCGACGATCTGCA
TCCTCTGCGTGGTCACATACATTTGTCGGCAAAAGCAAAAGGCCAAGAAA
GAAACAGTGAAGATGACCATGGCTCTGTCCGGCTGTGAGGATTCCGAGCC
GCTGCGTCCCTCGAACATTGGAGCCAATCTATGCAAGTTGCGCATTGTCA
AGGACGCCGAGTTGCGCAAGGGCGGAGTCCTCGGAATGGGAGCCTTTGGA
CGAGTGTACAAGGGCGTTTGGGTGCCGGAGGGTGAGAACGTCAAGATTCC
AGTGGCCATTAAGGAGCTGCTCAAGTCCACAGGCGCCGAGTCAAGCGAAG
AGTTCCTCCGCGAAGCCTACATCATGGCCTCTGTGGAGCACGTTAATCTG
CTGAAGCTCCTGGCCGTCTGCATGTCCTCACAAATGATGCTAATCACGCA
ACTGATGCCGCTTGGCTGCCTGTTGGACTATGTGCGAAATAACCGGGACA
AGATCGGCTCTAAGGCTCTGCTCAACTGGAGCACGCAAATCGCCAAGGGC
ATGTCGTATCTGGAGGAGAAGCGACTGGTCCACAGAGACTTGGCTGCCCG
CAATGTCCTGGTGCAGACTCCCTCGCTGGTGAAGATCACCGACTTTGGGC
TGGCCAAGTTGCTGAGCAGCGATTCCAATGAGTACAAGGCTGCTGGCGGC
AAGATGCCCATCAAGTGGTTGGCACTGGAGTGCATTCGCAATCGTGTATT
CACCAGCAAGTCCGATGTCTGGGCCTTTGGTGTGACAATTTGGGAACTGC
TGACCTTTGGCCAGCGTCCACACGAGAACATCCCCGCTAAGGATATTCCC
GATCTTATTGAAGTCGGTCTGAAGCTGGAGCAGCCGGAGATTTGTTCGCT
GGACATTTACTGCACACTTCTCTCGTGCTGGCACTTGGATGCCGCCATGC
GTCCAACCTTCAAGCAGCTGACTACGGTCTTTGCTGAGTTCGCCAGAGAT
CCGGGTCGCTATCTGGCCATTCCCGGGGATAAGTTCACCCGGCTGCCGGC
CTACACGAGTCAGGATGAGAAGGATCTCATCCGAAAATTGGCTCCCACCA
CCGATGGGTCCGAAGCCATTGCGGAACCCGATGACTACCTGCAACCCAAG
GCAGCACCTGGTCCTAGTCACAGAACCGACTGCACGGATGAGATACCCAA
GCTGAACCGCTACTGCAAGGATCCTAGCAACAAGAATTCGAGTACCGGAG
ACGATGAGACGGATTCGAGTGCCCGGGAAGTGGGCGTGGGTAATCTGCGC
CTCGATCTACCAGTCGATGAGGATGATTACCTGATGCCCACATGCCAACC
GGGGCCCAACAACAACAACAACATAAATAATCCCAATCAAAACAATATGG
CAGCTGTGGGCGTGGCTGCCGGCTACATGGATCTCATCGGAGTGCCCGTT
AGTGTGGACAATCCGGAGTATCTGCTAAACGCGCAGACACTGGGTGTTGG
GGAGTCGCCGATACCCACCCAGACCATCGGGATACCGGTGATGGGAGTCC
CGGGCACCATGGAGGTCAAGGTGCCAATGCCAGGCAGTGAGCCAACGAGC
TCCGATCACGAGTACTACAATGATACCCAACGGGAGTTGCAGCCACTGCA
TCGAAACCGCAACACGGAGACGAGGGTG

Insertion SiteChr.3, attP 86Fb
CommentsSequence based on a gene model from the Ensembl66 release
(FBtr0071654).
Log in to add this item

0 items