ventral veins lacking
Fly Line IDF003374
Construct IDP006533
CG/CR NumberCG10037
Symbolvvl
Gene Nameventral veins lacking
Gene Synonymsvvl; ut; Dfr/Vvl; Vv1; dfr; Cf1a; VVL; DFR; dfr-vvl; dfr/
vvl; Cfla; Cf1a/drifter; drf; Cf1-a; vvl/dfr/ut; prd3; CG
10037; sep; vvl/dfr; Drf; Dfr
FBgnFBgn0003995
TypeORF-CC
PlasmidpGW-CC.attB
Sequence

ATGGCCGCGACCTCGTACATGACGCCGCCGAGCGGTGATCTGGACATGGC
CCTCGGAGGCGGTGGCTATCACACCTCGTCGCCGCGCTCGGCGGCTGATG
CCGGTGAAATGAAGTACATGCAGCACCATCATCATCATCATGCCGCTGCC
GCGGCAGCTGCCCACCATCAGTTGCCCTCGTCGCCATCGCCCAATGGCCA
GGGCAATGGTGGCGGACTTGGATTGGGTTCCGGTTCCGGGTTGGGCTCAT
GGAGTGCCCTCCATCCGGATCCGTGGATGCAAACCCATCATACGCACCAT
CTGCCCGCCGCCGCTGCCGTTGCCTCGGCCGCTGATACCGTCAAGCAGGA
GATGTCGCATCTCTCGCAGCAGACGCGCATCCAACAGGGCATGGCCTCGC
CCCATGCCGCCTGGCATGCCCCCCATGCGGGACACTATGCGCCAACGGGC
GGGTCACCGTTGCAGTACCATCATGCCATGAACGGAATGCTCCATCATCC
GGCCAATGCGGTTGCAGCGGCCCATCATCAGAGTGTGGCGCCACTGCATC
ATACGCTGCGCGGGGAATCGCCACAGCTGCACATACACCATCACATGGGC
GGCGGCGATCGGGATGCCATAAGCGGCGGCGAGGAGGACACTCCCACGTC
CGATGATCTGGAGGCCTTTGCCAAGCAGTTCAAGCAGCGCCGAATCAAGC
TGGGCTTTACCCAGGCCGATGTGGGCCTGGCACTGGGCACTCTCTATGGC
AATGTGTTCTCCCAGACGACCATCTGCAGATTCGAGGCACTGCAGCTGAG
CTTCAAGAACATGTGCAAGCTGAAGCCGCTGCTGCAGAAGTGGCTGGAGG
AGGCGGACTCCACAACGGGTTCACCCACGTCCATTGACAAGATCGCCGCT
CAGGGGCGTAAGCGCAAGAAACGCACCAGCATCGAGGTGAGCGTGAAGGG
GGCACTGGAGCAGCACTTCCACAAGCAGCCGAAGCCATCCGCCCAGGAGA
TAACCTCGTTGGCCGACTCCTTGCAGCTGGAGAAGGAGGTGGTACGCGTG
TGGTTCTGCAATCGGCGGCAGAAGGAGAAGCGCATGACGCCGCCAAATAC
GCTCGGCGGCGACATGATGGACGGCATGCCGCCGGGCCATATGCATCATG
GTGGCTATCATCCGCATCACGATATGCACGGCAGTCCGATGGGCACACAC
TCCCACTCGCACAGTCCGCCCATGCTGAGCCCACAGAATATGCAATCCTC
GGCGGTAGCGGCGCATCAGTTGGCGGCCCAC

Insertion SiteChr.2, attP 21F
Comments
Log in to add this item

0 items