SMC2
Fly Line IDF001740
Construct IDP002411
CG/CR NumberCG10212
SymbolSmc2
Gene NameSMC2
Gene Synonyms
FBgnFBgn0027783
TypeORF
PlasmidpUASg.attB
Sequence

ATGTATGTTAAGAAACTAGTGCTCGACGGCTTCAAATCCTATGGCCGGCG
CACGGAGATAGAAGGATTCGATCCAGAATTTACGGCTATCACGGGTCTAA
ACGGCTCCGGCAAGTCAAACATCTTGGATAGCATTTGTTTCGTACTGGGA
ATTAGTAATCTCCAGAATGTGCGCGCTTCGGCTCTACAGGATTTGGTGTA
CAAGAATGGGCAGGCGGGCATTACCAAGGCCACTGTTACCATTGTGTTTG
ACAACACAAATCCCGCCCAGTGTCCGCAGGGCTACGAAAAGTGCCGGGAG
ATCTCTGTGACGCGCCAGGTGGTTGTCGGAGGCAAGAACAAGTTCCTCAT
CAATGGCAAGCTGGTGCAGAACAAAAAGGTGCAAGACTTCTTCTGCTCCA
TCCAGCTAAATGTAAACAATCCCAACTTCCTGATCATGCAGGGCAAGATC
CAACAAGTGCTAAATATGAAGCCCAAGGAGGTTCTGTCAATGGTAGAGGA
GGCAGCGGGAACCAGTCAGTACAAAACCAAGCGTGATGCCACCAAAACCC
TGATTGAGAAAAAGGAGACCAAAGTGCGGGAGACCAAGGTCTTGCTCGAC
GAGGAGGTGCTGCCAAAGCTGGTTAAGCTGCGCCAAGAGCGCTCCGCCTA
CCAGGAGTATCAGAAAATCTGCCGCGACATAGACTTTCTCATCAGGATTC
ACATCTCCGCCAAGTATCTCAAGCAATGCGAGACCCTCAAGACGGTGGAG
GCCAATGAGCACAAAATCGAGGATCGCATAGCGAACTGCAAGGCCACTCA
CGCCAAGAACCTCGCAGAGGTCGAGAGCATTGAAAACTCCGTGAAGGAGA
TGCAGCAGCAGATCGATGCAGAGATGGGTGGCTCCATCAAAAATCTCGAA
ACCCAGCTCAGCGCCAAGCGGGCACTAGAAGCTACCGCTACGGGTAGCTT
GAAGGCGGCCCAGGGAACGATTCAGCAAGATGAGAAGAAAATTCGCATGG
CATCCAAAAACATTGAGGATGATGAACGAGCCCTGGCAAAAAAAGAAGCG
GACATGGCCAAGGTTCAAGGCGAATTTGAAAGCCTCAAAGAGGCAGATGC
CAGGGACTCGAAAGCCTATGAGGACGCCCAAAAAAAGCTGGAGGCTGTCT
CGCAGGGACTCTCCACCAATGAAAACGGAGAAGCCTCAACACTGCAAGAA
CAATTGATAGTGGCCAAGGAGCAGTTCAGCGAGGCACAGACCACCATTAA
GACCTCAGAGATCGAGGTGCGTCATACGCGTGGCGTATTGAAACAGCGTG
AGGGTGAGACCCAGACCAACGACGCTGCCTATGTAAAGGATAAGAAGCTG
CATGATCAGTTGGTGGTTGAGATTAAGAACTTAGAACGGCAGCTGCAAAG
TCTCGATTACGAGGGCGGTCATTTCGAGAAGCTAAAGCAGCGACGCAATG
ATCTGCACATGCGAAAGCGCGATCTGAAACGAGAGCTGGACCGCTGCAAT
GCCTCCCGCTATGATCTGCAATACCAGGACCCAGAACCAAACTTTGATCG
GCGTAAGGTGCGTGGTTTGGTAGGCAAGTTGTTCCAGGTGAAAGACATGC
AAAACTCCATGGCTCTAGTCCAGACAGCCGGCGGAAGTTTATATAGCTAC
GTGACGGACGATGATGTGACTAGCAAGAAGATCTTGCAGAGGGGCAATCT
TCAGCGTCGTGTCACTTTGATTCCCATCAACAAGATTCAATCTGGCTCGC
TAAACAGAAATGTGGTAGAATACGCTCAAAACAAAGTGGGCGCCGAGAAT
GTCCAATGGGCCATGTCACTGATTGACTATGACCGCTATTACGAGCCTGT
CATGAAGTTTTGCTTTGGCGGAACACTTATCTGCAAGGACCTCATTGTAG
CCAAACAAATCAGCTACGACCCCCGTATTAATTGTCGTTCTGTGACTTTG
GAAGGAGATGTCGTCGATCCCCATGGCACAGTGTCTGGAGGTGCTGCTCC
TAAAGGTGCTAACGTTCTAGAAGAATTGCACGCAATTAAGCAAATAGAAA
AGGAGTACAGGGAGATCGACTCTGAGATAGCCCAAGTGGAAAAGCAAATT
GCATCCATTGAAAACCAGGCCCTCGCGTTCAACAAAATGAAGGAAAATCT
TGACTTGCGACAGCACGAGCTAACCATGTGCGAGAACAGGTTGGCCCAAA
CAACCTTTCAACAGAATCAGGCTGAAATTGAAGAAATGAGGGAAAGGGTC
AAGACCCTAGAGCAGCAAATAATTGACTCCCGTGAAAAGCAGAAGACCTC
GCAAGCCAAAATAGTGGATATCGAGGCGAAGTTGGCAGATGCAAAGGGTT
ATCGCGAGCGAGAGCTGAATGCAGCCACCAACGAGATCAAGGTGACCAAG
CAAAGGGCGGAGAAATCTCGTGCGAACTGGAAAAAGCGAGAGCAGGAGTT
CGAAACTCTTCAATTGGAAATTACTGAGCTGCAGAAAAGTATCGAAACTG
CAAAGAAGCAGCACCAGGAAATGATTGATAACCTCGAAAAGTTTAAGGCC
GAGCTAGACGCTCTGAAAGTAAATAGCTCCAGTGCCGCGTCCGAGGTGAC
GGAACTCGAACAGGCGATTAAGGAGCAGAAAGATAAACTGAGAGATCAGA
ACAAGGAGATGCGAAATCAGTTGGTCAAGAAGGAGAAAATGTTGAAGGAA
AATCAGGAGATTGAGCTGGAGGTGAAGAAAAAAGAGAACGAACAAAAAAA
GATCAGTTCGGATGCCAAAGAGGCAAAGAAACGGATGGAAGCCCTTGAGG
CAAAGTATCCGTGGATTCCGGAGGAGAAGAACTGCTTTGGCATGAAGAAT
ACTCGGTACGATTACAGCAAGGAGGACCCCCACGAAGCAGGCAACAAGCT
GGCAAAGATGCAGGAGAAAAAGGACAAAATGGAACGCACTCTCAACATGA
ACGCTATCATGGTGCTGGATCGCGAGGAAGAGAACTTCAAGGAGACCGAG
CGCCGGCGAAACATTGTGGCGATGGACAAGGAGAAGATTAAGAAAATCAT
AGTGAAGATGGACGAAGAAGAGCAGGATCAGCTGAACAAAGCCGCTACCG
AGGTGAACACGAACTTCAGTGGGATCTTTAGCTCCCTTTTACCGGGTGCT
GAAGCGAAACTCAATCCCGTCCATACCAATGGCTGTCTGACCGGTTTGGA
GATTAAAGTCGGCTTCAATGGCATATGGAAGGAGAGTCTCGGTGAACTTT
CTGGTGGCCAGAAGTCCTTGGTGGCTCTGTCCCTTGTCCTGGCCATGCTT
AAGTTCTCTCCGGCTCCCTTGTACATTTTGGATGAGGTGGACGCTGCCCT
GGACATGTCACACACCCAAAACATAGGTAGTATGTTGAAGCAGCACTTCA
CCAACTCGCAGTTCTTGATTGTGTCTCTCAAGGATGGTCTCTTCAACCAC
GCCAACGTCCTGTTCCGCACTCTCTTCGAGGAGGGTGTGTCCACCATCAC
CCGGCAGGTCAGCAGACAGGCGACAACCAACAAACGCTGA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items