portabella
Fly Line IDF003134
Construct IDP005579
CG/CR NumberCG10251
Symbolprt
Gene Nameportabella
Gene SynonymsCG10251; prt
FBgnFBgn0043005
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTCGGAGAAATCGAACCGTGCTCAAATACACTCCAACTCCCGATCGAA
ATCCCAAAACCAAGCGGCTGTTCAACTGAATGCCCCGGGCAGACGCAGCT
CCACTCCATCCGGAGCCAATGGCTCCTCCAATCGCTGCCTGATTGCCGTG
ATTGTTTACCTGGCCCTGCTGCTAGATAACATGCTGCTAACCGTAATTGT
GCCCATCCTGCCGGATTATCTGGCCAGCCTGGAGGCGGATACATCGTCCG
CGGTAGTGCTGAGTCTGGAGGACACATCGTCATTCTCGAAACTTGGCTAT
CGGTCTGGAGAATCGCCAGGCGGCGGTCATCCTCAACTGTACATTTCTAA
GCATCCGATTCCGGGCAAATCAATGGTTAACTTCACACTGCTCCAGCTGT
CCACAGAAGCCACAACCACGACCACCAGCATCGCCACAACGACCAACTCC
CCGCACAATTCTACGTCCATGCAATCGCCTCCAAAGCTGACGGTTGGCCA
GTCGGGCGGCACTAATGTCACTGGAATTGGGCACAAGAGCAGGAACAGGA
AGCTGGCCTCCGGCCATCCCCCCACCCACGACAACAGCAGCAATGACAAC
AGCAACAAGGAGCTGACCTTGACGCAGGAGAATGGCTCCATCGGCCTGTT
GCTGGCCATGAAGGCTCTGGTCCAATTAATTTTCAATCCGATTGTCGGCA
ATGCGTCCAGCAAGTTTGGTTACCGCCTTCCCATTGTGGTCGGCACCTTC
TTCCTGCTCCTCTCCTCGCTGGTTTTCACCGTTGGTGAATCCTACTGGGC
TCTCCTGGTGGCCCGGGCTGTGCAGGGCGTGGGATCCGCTTGCATCAACA
TATGCGGCATGAGCCTGGTGGCCCAGCATTATCCGGAGGAGGCACGTCGT
TCCAAGGTGATGGGCATCATCCTGGGCAGCATCGCATTGGGTGTGCTGCT
GGGCTATCCATTCGGTGGAATTCTGTATGACCTAATGGGCAAATCGGCGC
CTTTTATCATTCTCTCCACTCTGATGTTCCTAAGTTTGGGCCTCCAGCTC
CTGACCATGGATCTGACGGTGCAACCGGAGGTTGTGGTGGAGGATAGACC
CAAGTGGCGATCGCTGCTCGAATGCAAAATGATCCTGGCCATTGTGCTGG
CCATTTGGTTTTCAACCTCAACAATGGCCATGCTGGAGCCCTGTCTGCCC
ATCTGGCTAATCCAGTATCTAAAGCCTAACAAGTGGCAGCTGGGCACCGT
TTTCATTCCAGACTCTGTGGGCTACTTTGTGGGCACGAACTTCTTCGGCA
GCATTGCCTACAAATATGGTCAGGTTAAGGTGTCCTGTATCAGTTTGTTG
CTGGTGGGAGTAGCCTCTATTCTGATACCCAGTGCTACAACGGTGGCCCA
ACTATTGCTGCCCCATTTTGCCTTGGGACTGGGTATTGGAGTAATCGATG
CCGCATTGGTTCCACTCTTGGCCACCTTTGTGGATGCAACACTGGCTCAG
GAGGATCAGGGTGAGGGCAGCAGTTCCATGTCCAGCTACGGAACAGTCTA
TGCTATCCAGCAGACCTCTGTCAGTCTGGCTTATTGCTTAGCTCCCCTGA
TTGGCGGGGAGTTGGCCCAGACCTTTGGATTTGCTTGGCTGATGCGCATT
GTCGGCATTTTCAATATGATTTATGGCCCAATATTGGTCTACTTGCATCA
GAAATACGATCCAAAGGCCCTTAGGGAACAGCATAATGATATGCTGCTCC
AAAGCAGCGGGCGGGGATCTAGGTATAAACAACTTTACAACTCCATGGAT
GTGGAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items