D19B
Fly Line IDF000140
Construct IDP000508
CG/CR NumberCG10270
SymbolD19B
Gene NameD19B
Gene SynonymsCG10270; D19B; d19b
FBgnFBgn0022699
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAATGAGGAGAGCCAGTACTCCATACACACGGTGTGCCGCACCTGCCT
GTCCACGGTGGACGACTCGGCGGCCTACGATCTGTTCCGAGTGCCCGGTC
TGGCCAAAAAGCTGTGCGTGTGCACCTCCTTGTCCGTGGAGCAGGCGGAT
GGCTTTCCCAAGAACCTGTGCAATGTCTGCTTCTCCAAGCTGAACGACCT
GCACGACTTTCAGAAGCAGTGCGTCGATTCCGTTCAAAAGTTCCAAGATC
TGGTGGCCAGCAACGCGTTCGCCTGCCAAACAAACTTCGATGTTCTGGAC
ACCAGTGCCGCTGTGGCGGATCTGCCGGGCGAGGAAGAGGACAACGTGCA
CTTCGATCCGCTGCTCAACTCCAAGATCGAGATCATTGAGAACGAGGAGG
ACGTCTTCAAGATGCTCGAGTCCGTCGAAAAGGAGGTCGAAGAGGTGGAG
ATGGAGATGGAACAGCCGTTTGGCCGAGTATCTCAGGATGACTCCTTCGA
GAGCGGCAACGACAACGACCTCGACGCAGACTTCCAAATCAGTAGTGACG
ACGACATTCCACTGGCCCAGCGCAGCCGGCGTGGAGCCACTCGTGGTTCC
AAGGCGAAGGGCAAGCCGAAGTCGGCTGCCAAGCGACAGGAGGAGGAATC
CGAGGAGTCCGAGGAGACCAGCTCATCAGACGACTCCGATGGCAATCCGA
AGGACAAGCCCAAACGCAAGAGGATTCCTGCTACGGAGCGGGATCGCCAC
CGCCTGATTGACTGCCACATCTGCCACCAGAAGTTCAAGAAGGCGATTCG
CTACGAGGAGCACATGAAGCATCACAACGACTTGCTACCCTTCCAGTGCA
CCGTCGAGAGTTGCCGAAAAGGCTTTACCACCGCCAATGGACTGCGCGTC
CATGTGGAGCACGCCCACACGGAGACATCGGCTATGCATCCGTGCACCTA
CGAGGGCTGCAACAARTCCTTTGCCCGGCCCGTGCTGCTCAGCTTCCACA
TGAAACGCGTGCACAAGGTGGACACCCCGCAGAGGGACTTCCCCTGCACG
GAGTGCGAGAAGGTCTTCCGCTGCCCCACTGCCCTCAAGAAGCACATGTA
CAAGCACACGGGCGAGGAGCTGCCCTTCGCATGTGAAATTTGCGGCAAGC
GCTTCCCCATCAATAGTGTGCTGCGCGACCATCTGCTGCGCCATGCGGGC
ATCAAGAACCATGTGTGCCCGTACTGCGGAGTGGGCAAGACGACGCGCCA
GGAGTGGAACAAGCACATCCTTACCCACACGAAGGAGAAGAAGTACGAGT
GCCGGCAGTGCGACCACGCCTCCCACAACAAACAGGCGCTGGCCAACCAC
GTGAAGGTGGTGCACGAGAAGCGCAAGGACTTTGCCTGCCAGTACTGCGG
AAAGACCTTTGGCAAGTCGCACGCCTGCAAGATTCACGAGAGAAGTCATA
CCGGCGAAAAGTGCTGCGAGTGCAAGATCTGCGGCAAGGTGTTCCTCTTC
GAGAAGGGCCTAACCAAGCATTTGAAGACGCACGAGAAGCGTGATTTGCC
CAAGACGCAGGGGACCAATGCCTTAATGGGCGACGGGGCCAGTGGATCCT
CGACAATAGCCAAGCCCAGTCCGCACCTGCGTGGTCGCGTCGAGCGGGTG
GACATTGCTCAGTTGGCGGGAACGGTGGCCAATCCAATTCCATCGGTCAA
CCTGCCCTCGTGGTCGCCGCAAGTGAACTTCACCAAGAAGGAGGGCCAGC
ATATCTGCCCGGACTGCGGCAAGGGCTTCAATCACGTGAGCAACATGAAG
CTGCACTACAAGGTGGTGCATCAAAAGGTCAAAGACTTCTGCTGCCGCTT
CTGCCCGAAGAGATTCGCCAAGAAGCAGTACCTGCGGCACCACGAGTACA
TACACACTGGCGAAAAGCCTTACGAGTGCAAGGTGTGCGGCAAGCATTTC
CGGCAGGAGCAGGTGCTCAAGACGCATATGAAGGTGCACGACAAGCCGCC
CCGTCCGCCTGGCAAGCCCAAGGAGCCGGCTGGACCCAAGGCGGAGTCCA
GCACCGCGGTGAAGCGCCAGCAGCCGAAGAATTTCGAGCAATACCAGGAT
CCGGCGGCGGAAAGGGCAGCGGCCACCGCCGAGCTGCTGGCCTACCAGAT
CGAGGAGAACGAGGCCAAGCGCAAGGCGGAGGCGGAGCTCCGGAAGATCC
AGGAGGCTGCCTTCGAGCAGCTAAACAAGCTGCAGAAGCAGTCGAACACT
TACGACGGCTTCTACGCGCAGAAGGCGGAGGCGGAGGGCACCTCAGTGGA
CGCACTGAAGTTGGATCATGTT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items