Molybdenum cofactor synthesis 2
Fly Line IDF003517
Construct IDP005400
CG/CR NumberCG10238
SymbolMocs2
Gene NameMolybdenum cofactor synthesis 2
Gene SynonymsCG10238; Dromel_CG10238_FBtr0084782_mocs_mORF; Mocs2; MOC
S2; dMoaE; MBIP/dMoaE; Mbip
FBgnFBgn0039280
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGATCACGTGAAATTGGTAAACGACCCCATAGATATCGCTCATATCCA
TCAGTTGCTGGCCGATGAAGGCTGTGGAGCCTCATCCGTTTTCGTGGGCA
CTACGCGCGATAATTTTCAAGGGAAAAAGGTGCTGTCATTGGCGTACGAG
GCCTACGATAGCATGGCACTCAAGGAAATGAATAAAATATGCTCAGATCT
CCGATCTAAGTGGCTCGATCTGAAGCACATAGTCATATATCATCGATTGG
GAACAGTGCCCGTATGCGAAGCCAGTGTAGTTATAGCCGCCTCGTCACCA
CATCGTTCTGAGGCCTTAGAATCAGTATCTTTTGCAATAGACCAGCTAAA
AACTCGGGTTCCCATCTGGAAAAAGGAAATCTACGACGGCGATAACGACA
GCGAATGGAAGGAGAACAAGGAGTCCATCAGGCCTAAGAAATCGAAAAGT
GGCTTCAACTACGCCGCTTGTCCCTGCAAAGTTGAGGAGTCACATGACGT
CCCGCGAACTCTGGTGCAAATTAGAGTTAATGACGCTGAGTTAACCAAGC
GTTTAGAATGTTTTGTCAACAGAAAACGAGACGAAATAAACTCACAAAAT
GTAATTGACTTCAAATCGTCTTTTGTCAGCTCAGACCAAAACTTGAGCGA
TTCCTGCGCTCGAACGCAGAGCACAATTATTAAGCAGGAGCAGTCAAATT
GCCATTTAAAAGTCCGACGAGTAAACAACCGATGCGGACCTCAGCAAATG
GAAATGCGACCCAACTACGAACTCGAACTGAATAAACTAATGGGATCGCG
TGACGGTCAAACGGATCCAACCAAAGAAATGAGGAAATCGCTACCCAATT
CACGACTACAGGCAATTGAATCGTACATGGGTCTAACCACCGACAACGAG
GAAAACATTTTCAGTAGAATCAAACGAGTGGAAAATAGACTGCTGCAACT
GGAGTCCATTTCGCCCGAGTACAGACACTTCACCAAACGTGAACCGTCAT
CTATGGAAGCCGCGCCGCCGAAGAAGAGCCGAAAGAAATCGTATTCGGCG
CAAGAATTAAGTGCATTCATTCAAAAGATTAAGGATGGCAGCGAATTAAG
C

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items