CG1024
Fly Line IDF000623
Construct IDP001677
CG/CR NumberCG1024
SymbolCG1024
Gene NameCG1024
Gene SynonymsBcDNA:LD21969; CG1024
FBgnFBgn0027514
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTCGCGGAACGTGACGCTCTCGGATGAACAAAGTCGGCTTAATGCGCG
TCTGGAGGCGCACATGGTTTACATATGTCCGGAATGCGGCAAGGCGTTCC
GCACTCAGGCGGAGTGGCGACAGCATCTGAACACGAAACACGACTATCTA
AAGAAGACGTACTCAGATTTCAACTTCATCCAGATCGACGAGCGATTCCA
TGAGTGCCAGCTGTGCTTCAAATGGGTGGAGAATGCCCACAAGACAATCG
CCCTCCTGCAGTACCACTACTTTATGCATCTGGAGCACAGTGAAACCTAC
CGCTGCGTGCACTGCCGCATGGCGTACACGAGGCGCCGGGCTCTGAACGT
CCACCTACTGGACACGCACATGCGGGAGATCGAGAAGTACGAGAACAAGC
TGCGCCAGATGAAGCGGCAGCAGGCGAAACCCACTACAGCGGCCGCACCA
GCTGGAAATGCAGAGAAGCCGATGGCTGTGAAGCCGCGTGGGCGTCCCAA
AGGTTCCACGAACAGAAAGCAAAATGATCTGCTGCAAAAGGCGCTGATGG
ACATTGATCTGAACACAGAAATGGAAAAGTCCCCAGTGACAGCACTAGCG
GCTCCTGTAAACGAACCTAAGCCCATTTCAAATGTCAGCGAGCTGAATCT
AGATCGGTGTTTGAATGCCTACGAGGACATCGTGCGCAAGGAGGAGAAAG
AGGTGGTGCCGAAGTATGACGACGAGTTGGATGCGCTCTGCAAGGAGTTT
TTTGATGATGGCCCCTCCGCCGGCAAAGGAGAAGCTAATGAGGAGCAGCA
GCAAGACGATGCGCACCTGCAGCAAGGAAATCAGGAGGTGGTCATCATCG
AGATCGATGCACTCGGCAAGGAGGAAGTGGCCCAGCTGAAGAAGGAAATG
AAGTCGGACCCAATAAGTCAACCGACTAAGCGTCGACGCATCTCTACGAC
GCCCAGCCGCGACTCAGACACGGAAATGTCCACCAACGGCCTCACGAAGC
TCATATCGTACTTGTGTCCGAAGTGCGGCAAGGAAATCGCCTCGATGGAC
GGTTGGCGGGCACACGTATTCAAGAAGCACGACTTCGAGCACATAATCGA
GAACAGTTTTAAGATCCTGGAGTCCGGGCGCAAGGCCATGTGCCTGCAGT
GCCGTGAGGTGCAACCAACGACCGTGCGCTCACAACTGCAGAAGCACTGC
TTCAAGCATCTGCCCTACCGGTCGTACCTCAAGTGCACACTCTGCGATCG
CACCAAGACCAGCACCTCAAAGATCCTCAATCACATTCGCTACAACCACC
AGGAGGAGCTGCAGCGTAAAAACAAGACGCAGCTGCTTATTAAGCCGGAG
CCCATGTGGGCCAGTCCCAACAAGTCCGGTCAAGCGGCCATGGCGGATGA
CGCCGGATCCGAGGACGATCAGGGCGAGCAAGCTGTGTGCGAGCACTGTG
ACAGAGTCTTTAGGAGCAAATGGCGCTACGAACGACACATTGCCTCTTGC
AGGAGATCTGGAGCTGGCAAGTCAGTCGAAGGGACCGTTGAAGCCTTGTT
GAACCATCTGCGAGAAGGGCACATGCGAATGAACGCCATCTGGAAGACGA
TGCAACGTGAAAAGCCT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items