CG10277
Fly Line IDF000771
Construct IDP002703
CG/CR NumberCG10277
SymbolCG10277
Gene NameCG10277
Gene Synonyms
FBgnFBgn0037442
TypeORF-3xHA
PlasmidpUASg-HA.attB
Sequence

ATGTCCAAGAGAAGTTGCCAGATACTCACCCTGTTGGGCTTGTGCCTGGT
CTGTCATGAGGCGACCTTGGTCGGGGGCCACGTGCTGGTTTACCGGAAAG
CAACCAGCCAGTTGATCGAGGAGTTCAATGATCTGCCAGCTCAATTCGGT
CCCAATCTGCCTTCAAATGGTCTCAAAGTGTATGTGGTTCCCGCTAGGCG
CCCTTATTACGGTTGTGATAGCCTGGACAGACCACCGCACCTGAAATACC
CACCCTCAGCCAAATTTGTGGCACTTGTAGCGCGTGGCGAATGCGTCTTT
GAGCGTAAGATACGAGTGGCCCAGAATGCGAGTTATTCTGCTGTGATTGT
TTACAATAATGAAGGCGATGACTTGGAGCAAATGTCCGCCGAAAACATAA
CGGGTATAAGAATACCCTCGGTTTTCGTGGGCCACACGACGGGTAAAGCG
CTGGCCACTTACTTTACGACCGAGGTGGTGCTAATCATCAACGATGAGCT
GCCCTTCAATATCAATACACAGTTAATATTGCCGTTTTCCATTCTGATCG
GTATGTGCTTCATCATAATGGTTATCTATATGATCTACAAGTGCATCCGC
GAGCAGCGCCGCTTGCGTCGCCATCGACTGCCAAAGAGCATGCTGAAGAA
ATTGCCAGTGCTCCGATATACCAAGAACAACGCAAACAACAAGTACGACA
CCTGTGTGATCTGTCTGGAGGACTTCATAGAGGACGATAAGCTTCGCGTG
CTGCCCTGCTCACATCCCTATCACACGCACTGCATTGATCCATGGCTTAC
CGAAAACCGTCGGGTGTGTCCCATTTGTAAGCGCAAGGTTTTTACGAAGG
GCGAAGCGCGTGCAAGTCGGAGTCGACAGCCTTCTTTGGATAATGTCACG
GATACGGATGACGACACAACGCCGCTGCTGCAGCAACAGCAGTCCAATGG
TAGGCAGGTGGGTCAAGTGAGCTCGGCTTCTTCGGCTGGTGGAGCAGCTG
GGAGCAGCTCAAGCGTTGCGGCGGCGGCTGTCGCTGGAACCACGCGACAT
GGAACCTTCCGCCGTGGTCACGCCGGTCGAAATCCGTTCGAGGAGTCCCA
AAGCTCTGACGATGAGAACGCTCTGCTGGCCTCTACTGTGCGCCCGGCCA
CGTCTTCTGGAGCACATGAACGCATCAATCCCTTTGATCGTGCTCCGAAT
CTACCGGCCCACCTAGCCGAACAGTTAACTGAGAGTCGTCGCTCGGTCTG
GTCGAGAATAAATTTTGCCTCGTTCTTCCGCCGGCAGCCAGCTGTTATTA
GTGTGGCGGCGCCACCCTATCTGGAGCGCGTTGAGTCCGGTACCAGTGCC
ATGGGTCTGCCGGTGACGGGGACAATTGCTGTAGCCTCGCCCGCATCGAA
CAACATCCTCAATCCGAATTTAAGCGGCTCCTTTAAGGACGAAGACGATA
TGCCACCGCATCGTTCGATCTACGAACCGATAGCAATCAGCACGCCTGCA
GCTGACTCAGCAACAGTCGACGATTCGGCGTTTCTGCAAACGCCCACGCA
AGGCGGCATAGGCGTGGCCGCCCTGCCGCACAGCGCATCCGATCGCCAGT
TTCTCATA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items