knot
Fly Line IDF003475
Construct IDP006698
CG/CR NumberCG10197
Symbolkn
Gene Nameknot
Gene SynonymsCol; CG10197; col; collier; Kn; kn; Col/Kn; knot; coe; Dm
COE
FBgnFBgn0001319
TypeORF-CC
PlasmidpGW-CC.attB
Sequence

ATGGAGTGGGGCCGGAAGCTGTACCCCAGTGCCGTTTCCGGTCCGCGATC
CGCCGGCGGCCTGATGTTCGGCCTGCCGCCCACCGCCGCTGTGGACATGA
ACCAGCCGCGCGGTCCGATGACCTCGCTGAAGGAGGAGCCGCTGGGCAGC
CGGTGGGCCATGCAGCCAGTCGTTGACCAGAGCAATTTGGGCATTGGCCG
CGCCCACTTTGAAAAGCAGCCGCCCAGCAATTTGCGCAAGTCGAACTTCT
TTCACTTCGTGATCGCCTTATATGATCGGGCTGGACAACCGATCGAAATC
GAGCGGACGGCTTTCATTGGATTCATCGAGAAGGACTCGGAATCGGATGC
CACCAAGACGAACAATGGCATCCAGTACCGGCTGCAGTTACTCTACGCAA
ATGGAGCTCGCCAGGAGCAGGACATTTTCGTGCGTCTCATCGATTCGGTG
ACCAAGCAGGCCATCATATATGAGGGTCAGGACAAGAATCCCGAGATGTG
TCGAGTGCTCCTAACGCACGAGGTGATGTGCAGCCGCTGCTGTGATAAGA
AGAGCTGTGGTAACCGCAACGAGACGCCATCGGATCCCGTCATTATTGAT
CGCTTCTTCCTGAAATTCTTCTTGAAATGCAATCAAAACTGTCTGAAAAA
CGCTGGCAATCCGCGGGATATGCGCCGATTTCAGGTGGTAATTTCTACGC
AGGTGGCCGTGGATGGACCACTATTGGCCATCTCCGACAACATGTTCGTG
CATAACAATTCGAAGCACGGACGGAGGGCCAAGCGGCTGGACACCACGGA
AGGTACAGGCAACACATCCCTGTCCATTTCCGGTCACCCCCTAGCGCCCG
ACAGTACCTACGATGGTCTCTACCCACCGCTGCCAGTGGCCACGCCCTGC
ATCAAGGCGATCTCGCCCAGCGAAGGCTGGACAACCGGTGGCGCCACCGT
GATCATAGTGGGCGACAACTTCTTCGATGGCCTGCAGGTTGTGTTCGGCA
CCATGCTGGTCTGGAGCGAGCTAATTACCTCGCATGCGATCCGGGTGCAG
ACCCCGCCAAGGCACATCCCCGGCGTGGTGGAGGTGACGCTATCCTATAA
GAGCAAACAGTTCTGCAAGGGATCACCCGGTCGCTTCGTCTATGTCTCTC
TCAACGAACCCACAATCGACTACGGTTTCCAGCGCCTGCAGAAGCTCATT
CCCCGGCATCCCGGCGATCCCGAGAAGCTCCAGAAAGAGATAATCCTCAA
GAGGGCTGCCGATCTGGTCGAGGCGCTGTACTCCATGCCCAGATCTCCGG
GCGGCTCGACGGGCTTCAATTCCTATGCCGGTCAACTGGCGGTCAGTGTC
CAGGATGGCTCCGGCCAGTGGACCGAGGACGATTACCAACGGGCGCAGTC
GAGCAGCGTGAGTCCACGTGGTGGCTACTGCAGCAGCGCCTCCACGCCGC
ACAGCTCGGGAGGATCCTACGGTGCCACGGCGGCCAGTGCAGCGGTGGCA
GCCACGGCCAATGGCTATGCACCTGCACCCAACATGGGCACACTCTCCTC
GTCGCCCGGCAGCGTCTTCAATTCCACGTCAAGGGTCAGCAGCCTGAGCT
TCAATCCCTTCGCCCTGCCCACCTGCAATACACAGGGCTATAGCACCCAA
CTGGTGACGTCAACCAAA

Insertion SiteChr.2, attP 21F
Comments
Log in to add this item

0 items