brother of odd with entrails limited
Fly Line IDF000444
Construct IDP000496
CG/CR NumberCG10021
Symbolbowl
Gene Namebrother of odd with entrails limited
Gene SynonymsBowl; 17-29-5; Su(tor)2-1; l(2)c; org2; CG10021; bowl
FBgnFBgn0004893
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCCCACGGAAAGCTCATCCAGCGAGATCTCCGGCGGAGGAGGCGGTGC
GATACCCATGCTGCGACCTTCCCGGATGGATCAGTTCATGAACTCGATGG
CGGCGGCAGCGGCGGCGGTGGGTGGTGGCGGTCTTCCTGGTGCGGCGGAT
AGGAACGGCGGATCCGGAGGATCGGATGGTGGCTCCCAGAATGGCAACGG
CGATTCGCGCAACTCATCGGCCAGCCGGATCTCAGCGTATGAAACACAGC
TGGCCTATCAGCAGCATTTGGCCGGACTGCATGGTCCGCCGCCACCGCCA
CCACCATCGCATCATCGCGAGATCTCTGCCTTTGTGCCGGTTCTGCCCAC
CGGAAAGGTGCGCCCGGGTAGTAATTCCAATTACGAAATCATTGCCATGA
TGGCGGACAAGCGAAAGGAGTTGGCCCTAAGGGAGGCGGCTGCGGCGGCG
GCAATGTTAGGACGAGGTCCTGGAGGACCCGGCGGTCCTGGTGTGCCACC
GCCTGGAGTGTTGTACGGACCAGCTGGCGTGCCACCTCCGCCATATCTCA
CCGGACCGGGTCCATCGCCCACGGGAGCCGGAAGTTTTCCATTTCCACCA
GGAGCCGCCGCCGCAGCTCTATTTCCACCTGGCCTGGGTCCTGGAATGCA
TGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCATCGCGGC
CTAAAAAACAGTTCATCTGCAAGTTCTGCAATCGACAATTCACCAAGTCG
TACAATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTATTC
CTGTGATATCTGCGGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATC
ACAGGTATATTCACTCCAAGGAGAAACCCTTCAAATGCACGGAATGCGGC
AAGGGATTCTGCCAATCGAGAACCTTGGCTGTCCACAAGATCCTGCACAT
GGAGGAATCACCCCACAAGTGCCCCGTCTGCAGTCGATCATTCAATCAGC
GCTCCAACCTGAAGACCCATCTGCTCACCCACACGGATCACAAGCCCTAC
GAGTGCTCTTCATGCGGCAAAGTTTTCCGCCGTAACTGCGATCTACGACG
CCATGCCTTGACCCATGCAGTGGGTGAGGTCAACTCCGGGGACTATGTGG
ATGTGGGCGAAGAGGATGAGGCCAGAAATTTAAGTGGCGACGAGGAGGAT
TCGTTGCTGGAAGTGGACTCGCCTCGCCAGTCGCCAGTTCACAATTTGGG
CGAGTCTGGAGGATCGGGTGAGAAATCTGAGTCCGAAAGAATGAGACTCA
AGCGCAAGGCAGCCATCGATCATGAGGAAAGCGAAGAGGAGTTCGATGAC
TTCGACGAGGAAGAGGAACTGCAGGATCTGCCAAGAGTACACGATTTGCC
CAGGGAAGAGGACGACGACTTTGATCCCGAGGACGAGGAGCAGGCAGAAG
TGGCACTAGTGGCGCGTTTCCAGGCGAGTAAGGCTGCCGCCACATCGCAA
TCATCGTCGTCAGTGGGCACCAAGCCGGAACGCCAGGGAGTCACCCACTG
TCATCATGAGGGTGGTGAAACCTACACAATGCGGCCACATGGCGAGAAAC
ATCAGGAGGAACCCGGGAACTCTGGCATTGCCAGCCTACCCGTTCCACCT
TCCTTTGTGCGATATTCTGTACCACCTGGGGCAGCTGGACCGCCGCCTGC
ACCACCTGGAGCTCCTCCGCCAACCCACCAGCACCCAGGACATCCACACT
TACTCCCACCCAACGGGGATCCCTATTTGCCCATTCTGCACGTTCGACGC
GACTTGCACCACAAGAGCTTGAACCTTTCGAAGGCTGGTGTTCCACCGCC
ACCACATACACCACCCACTATAATAACCCAGCCGGAGTCGGGTAAACCAC
CCAATCAACCTTTGCATTCACCGCATGAAGCTATGCCCAGCTTCCTGGGA
TCGATACCCATGCGAAAGAGGATTCTTCCGGCACCGACCTTGGACTTGAT
GGATCCGCACCACCATCCTGGATTGGGTCAAAGGACCTTTGTGGATAGTC
CCAGCATATATGCTTTGAATATGTCGCGACATCCCCCCAGACAGCTTCTG
GGAAAACCACCGAGTACGGAAACAAGTGGAGCCACCACCGAAAAGGGACC
ACCAGTGGCAGCACCGCCCATAGCACCACCGCCTGCACCACCGAGAAGAA
CAGGGTTCAGCATTGAGGACATAATGAGGCGT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items