Dorsal interacting protein 3
Fly Line IDF000005
Construct IDP000062
CG/CR NumberCG12767
SymbolDip3
Gene NameDorsal interacting protein 3
Gene Synonymsdip3; CG12767; anon-WO0118547.169; Dip3
FBgnFBgn0040465
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAGCCGAAAGAACGGAAACCAGGACACCTTTCCCAAGACGGAGAAGAT
GCAGCGCTACTACGCGGAGCGCGAGACCACAGGACCCGAGTTCGACGATC
GCCTGATAAAGCTTGTGCGCGCCAATCCGGCCATCTATGATGTCAGCCAT
CCGCACTATCGCCGTAATCCGGTGCGGGTGGACATATGGGATCGCATTGC
CAACGAACTGGGCGCCTCCTCCCGATTTCTGCAAACCAAATGGAAGAACA
TACGATACAACTATCTGCAGGAGGTCAAGGCGATTGAGACGGGCCAGGCG
AATCCGAACGTACGCAAGCGGCGCTTCACTGAGGATCTATCCTTTCTGCA
GAACACGGCCCAAACCTACAATGTGAAGAAATCCCAGAGCTACGTGGCCC
AACAGAATGGAATGGGAAGTGACAACGACAGCAATAGCTTTTTGTATCCC
GATCCGGAGCACCTAAAGATCGACGCCTCCGAGGGCTACGACATCATCGA
GCTGGACAACAGCGACGATGGCTCAAATAGCGACGACAACGAGATTGTGC
CCGAGTTGCAGCTGGTCATGGGAGAGTCCAAGCAGCAATTATCCCTGCCG
ACGACACTGAACGGCACCAGCAGCAGCAATCACAGCCACGAACATGACCA
AGCCAGCTCGCCGGCCTCCTCGCCCCTGCTAACGCCGATGGTTGTAATGG
GCAATGGCTATGGCCAGGAGGTGCATCTAGAACAGCAGCAGACACAGGAG
CAAAAGCCGTTCAAGAATAGCTCGCTGTCCAACGGAGAAGTGACCATTGA
GCCCATTTACAAGCCTGCGGCTATCAGACGCGCATTACCCAGCGATTTTC
TGACCAATCCCTTCAAGCGCAAGGCAACCCAAGCGCCGCTTCAGACCCAA
GTGACGTCGTCCTTCAACGATCCCATCGAGCTCTACTGCCTATCGCTGGT
GGACACACTGCGCAGCATGCGGAGATCGGAACGGGAGCGGGTCAAGTTCG
AGTTCGCCAACATTCTGAAGGACGCCAAGTACAAGGACGAAAGC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items