Fly Line IDF001883
Construct IDP003231
CG/CR NumberCG3858
Symbolgcm2
Gene Name
Gene SynonymsdGCM2; CG3858; gcm2; Gcm2; FBgn0019809
FBgnFBgn0019809
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGTTGTTATAAATGGCTACAGCTTCAAGACGCAGCAACTTCTCACACA
GCAACCCGATCATTCTCAACTTACCCAGTTTGTCCAGCCCCAAAATCAGA
GTACGCATCCGGTGCATCCGTGTCCAAGTCCTGGTCAGCAGCAGGCGGGT
GGCTCCATGACCATGCCGTCGTCGTCGACGGGCAAGGGAAAACGTGAGTG
GGACATCAATGATGCCATTGTGCCACATGTGCCGGACCAGGAGTTCGACG
AGTTCAACGAGTGGAGCGACGGGCATGTGAGGCACATCTATTCGCTGCAC
AACGAGGAGGCCAAAAAGCACATTTCCGGCTGGGCCATGCGCAACACGAA
CAACCACAACGTGAACATTCTGAAGAAGAGCTGCCTGGGCGTCCTGGTCT
GCTCCCAGCACTGCACCCTGCCCAACGGATCCAAGATCAACCTGCGCCCA
GCCATTTGCGACAAAGCCCGGCGGAAACAGGAGGGCAAGGCGTGTCCCAA
CAAAAGTTGTCGTGGCGGTAGACTAGAGATTAAACCGTGTCGCGGTCACT
GCGGCTATCCGGTGACCCACTTCTGGCGGCACTCCGGCAATGCCATCTTT
TTTCAGGCCAAGGGAGTGCATGATCACCTGCGTCCGGATCCGAAGAACTC
CAGTGTTTCCAAGAGGGCCTTTGGACGTGTGCCGCTGGCTGGAAAGTCAG
CAAACGGATCAGTCGCCAAGAAGTCGGTCATTGCGGGTCTGGTAAAGCAG
GCGAAGCAACAACACAGTCTGATTAGCAAGGTTCTTAAGCGTCCTGCTGT
CAGCAATCCTCTGGCTCACACCGCATTGGATATATATCAGTATAATGCCT
GTGGCAAGTGCGCCGGTTATAGCCACTGCACTTGCAGCTACCTGGATGAC
AGCACCACGGCGAGGAGCCATCAGTTGTCACAATCCTCGAATTACGGCAC
CAATTCTTGGCCACTAAGTGGATCCGAGTCATCGGCGCCCTGCGAGACGG
CAGCTAATGTGTTTACGGTCAACCACCAGCACATCACCTACAACTATCCC
ATCTACCATGCAACTCCAGCGGCGGCCACCGCGGCACCTAGTAAATCTCC
CAGTTTGCCGTACGCCTGCAGCATTTCGGAACTGGCCGCATACCAGCAAT
CCTCCAGCGGAAATAGCTTTGCGATGGGTGTTCCCGTGCACGGACACACA
CAATGCCAGACAGTAGCCTATGATTCCAGCCCGCAACTGGCCACTCCGGA
ACCGGAGTTCATCAACTACTCGCAGATCAAGCATTTGGGTGGTGGCGGTG
GTCAGGAGGAGATCAGCTGCAAGGCCGAACCGGGACCCACCATTAAGTAC
AATGCCACCGTGGAGACGCAGCCGTATGTGGAGGACAACTACGATTACTA
CTATAGCCCCAAGGCGGAGTACGAAATGCAACAGCACCACCACCAGCAGC
AGCAGAGCCACCAACAGTTCGGTGGAAATCAGACAGCGGGACATCACTAC
TACGAGAGCAGTAGTGGCTATAATGGAGTCAGCTATTTCGACACAGGAAC
TACTACGGCACCAGGAAATACTGCAACCGGAAATGGCCTGGAAGTCGGAT
ACGGCGGCTACTACGATCACTACACCAATTACGAGCAACAAATGGCAGTA
GCAGGTGGATTTGCCACTGCCGGAGGATCCACTGCGCCGGCAGTGGCCGC
GCCCCCTGGCCATCCACCGCCTCCACCACCACCGCCCACGCTGACGTACC
ACCATCACCATCACCACCACTTGCACCACCCAGCAGCAGCTACAGGCCTA
GCCCCATCGGTCACCCAT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items