alien
Fly Line IDF001444
Construct IDP002009
CG/CR NumberCG9556
Symbolalien
Gene Namealien
Gene Synonyms
FBgnFBgn0013746
TypeORF
PlasmidpUASg.attB
Sequence

ATGTCCGACAACGATGATGATTTTATGTGCGACGATGATGAGGACTATGG
ATTGGAATATTCCGAAGATAGCAACTCGGAACCGGATGTGGATTTGGAGA
ATCAGTACTACAACAGCAAGGCTCTGAAGGAGGAGGAGCCCAAAGCGGCG
CTGGCCAGTTTCCAAAAGGTGCTCGACCTGGAAAATGGCGAAAAAGGAGA
GTGGGGCTTCAAGGCGCTGAAGCAGATGATCAAGATCAACTTTAGGCTGT
GCAACTATGATGAAATGATGGTGCGCTATAAGCAGCTACTCACCTACATC
AAGAGTGCCGTCACCAGGAACCATTCGGAAAAGAGCATCAATTCGATCCT
GGACTACATATCCACATCGAAGAATATGGCACTGCTCCAAAACTTTTACG
AGACCACTCTGGATGCTTTGCGGGATGCGAAAAACGATCGGCTGTGGTTT
AAGACCAACACCAAGCTGGGCAAACTCTACTTCGACCGCAGTGACTTTAC
CAAGCTGCAGAAGATACTAAAGCAACTGCATCAAAGCTGTCAGACGGACG
ATGGCGAGGACGATCTGAAGAAGGGCACTCAGCTCCTGGAAATCTATGCC
CTGGAGATTCAGATGTATACGGTGCAGAAGAACAACAAAAAACTTAAGGC
CCTCTATGAACAGTCACTCCACATCAAGTCGGCCATTCCCCATCCCCTAA
TCATGGGTGTGATCCGTGAGTGCGGCGGTAAAATGCATCTACGAGAAGGC
GAGTTCGAAAAGGCACACACGGACTTCTTTGAGGCGTTCAAGAACTACGA
TGAGAGCGGTTCACCGCGCAGAACCACTTGCCTAAAGTACTTGGTGTTGG
CCAACATGCTGATGAAATCGGGCATAAATCCCTTTGACTCACAGGAAGCC
AAACCGTATAAAAATGATCCGGAAATCCTTGCTATGACAAACCTGGTCAA
TTCCTATCAAAACAACGACATCAATGAGTTTGAAACCATCTTAAGGCAAC
ATCGCAGCAATATCATGGCCGATCAGTTTATACGTGAACACATCGAAGAT
TTGCTGCGTAACATTCGCACCCAGGTGCTTATAAAACTTATCAGGCCCTA
TAAGAACATCGCTATACCCTTCATAGCCAATGCACTGAACATAGAGCCAG
CCGAGGTGGAAAGCCTGCTGGTTTCCTGCATTCTAGATGACACAATCAAG
GGACGCATCGACCAGGTGAATCAGGTGCTGCAGCTGGACAAGATCAACAG
CAGTGCCTCGCGGTACAATGCCATTGAAAAATGGTCCAACCAAATCCAAT
CACTGCAGTTCGCTGTGGTCCAGAAAATGGCCTAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items