14-3-3epsilon
Fly Line IDF000748
Construct IDP002547
CG/CR NumberCG31196
Symbol14-3-3epsilon
Gene Name14-3-3epsilon
Gene Synonyms
FBgnFBgn0020238
TypeORF-3xHA
PlasmidpUASg-HA.attB
Sequence

ATGACTGAGCGCGAGAACAATGTGTACAAGGCAAAGCTGGCCGAACAGGC
CGAGCGCTACGACGAAATGGTGGAGGCCATGAAGAAGGTCGCCTCCATGG
ACGTAGAGCTGACCGTCGAGGAGCGAAATCTGCTGTCGGTGGCGTACAAG
AATGTGATTGGAGCACGCCGTGCCTCGTGGCGCATCATCACCTCGATCGA
ACAGAAGGAGGAGAACAAGGGGGCCGAGGAGAAATTGGAGATGATCAAAA
CCTATCGCGGACAGGTGGAGAAGGAGCTGCGCGACATCTGCTCGGATATA
CTGAACGTGCTCGAGAAGCATCTCATTCCATGCGCCACATCCGGCGAAAG
CAAAGTATTCTACTATAAGATGAAGGGCGACTACCATCGCTACCTGGCCG
AATTCGCCACCGGCTCCGACCGCAAGGATGCGGCAGAGAACTCGCTGATT
GCCTACAAGGCGGCCAGCGATATTGCCATGAACGATCTGCCACCAACACA
CCCCATCCGTTTGGGCTTGGCATTGAACTTCTCGGTGTTCTACTATGAGA
TTCTCAACTCGCCGGACCGCGCTTGCCGCTTGGCGAAAGCCGCTTTCGAT
GATGCCATTGCCGAGTTGGATACACTGAGCGAAGAGAGCTACAAAGACTC
GACACTCATCATGCAGCTGCTGCGCGACAACCTCACATTATGGACGTCCG
ATATGCAGGCAGAAGAAGTAGACCCCAACGCAGGTGATGGCGAGCCCAAA
GAGCAAATCCAGGATGTTGAGGATCAGGACGTGTCG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items