Aminolevulinate synthase
Fly Line IDF004487
Construct IDP008945
CG/CR NumberCG3017
SymbolAlas
Gene NameAminolevulinate synthase
Gene SynonymsAlas; CG3017; alas; ALAS
FBgnFBgn0020764
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCAGTGTCCGTTCTTGAACCGCTTCACCGCCAGCTTCATCCGCAACTA
CGCGGAGACGCTGTGCCAATCCTACGGGAGCCACTGTCCCGTGGTTGGGA
AGACCTTGGTATCCGGCGAGAAGAAACTTTCACTCGTCGCCGCAAGTGTT
ACAAGGTCTCACTCGACGGGGGCGAACGCCCACGCCAATGCTGGTGGCCC
CGCAACTGCCAACGCCACCGCTCCCGTCTCCGCCCCCGCCTCTGCCGATC
CTGGCAAGGCATCCGCCAAGGAGACCTTTCCCTACGAGCGCTTCTTCAAC
GAGCAGATCATGAAGAAGAAGCGGGACCATTCCTACAGGGTCTTCAAGAA
GGTGAACCGCCTGGCAGGCGACGGGCTTTTCCCCCACGCCCTGGAGTACT
CGGAGCGGACGGAAAAGCCCATTACGGTGTGGTGCTCCAATGACTACCTG
GGAATGTCCGCCCACCCCGGCGTCAAGAGGGCCGTCCAGGACGCGCTCAA
TAGGCACGGATCGGGGGCTGGCGGCACCAGGAACATTTCGGGTAACTCTC
TTCACCACGAGCGCCTCGAGAGTAAGCTGGCTGAGCTCCACCAGAAGGAG
GCTGCGCTGCTGTTCACGTCGTGCTTCGTGGCCAACGATTCCACTCTCTT
TACGCTCGCCAAGCTCTTACCTGGGTGCGAGATCTTCTCGGACGCAGGGA
ACCACGCTTCCATGATTATGGGCATACGGAACAGCGGGGTTCCCAAGCAC
ATCTTCCGGCACAACGACGTGGACCACTTGCATCAGCTGCTGAAGCAGAC
GGACAAAAGCGTGCCCAAGATCGTCGCATTCGAGACGGTACATTCCATGA
CGGGGGCCATCTGCCCGCTCGAGGAGCTGCTTGACGTGGCCCACGAGCAC
GGGGCCATCACGTTCATCGACGAGGTGCACGCCGTGGGATTGTACGGTGA
CCACGGGGCCGGGGTCGGTGAGCGGGATGGTGTGCTGCACAAAATGGACA
TCATATCGGGCACCCTGGGCAAGGCGTTCGGTAATATTGGTGGCTACATA
GCTGGCACCCATAACCTGGTCGACATGATTCGGTCGTATGCGGCCGGTTT
CATCTTCACCACCTCACTACCGCCGACTGTACTGTGTGGCGCCCTGGAGG
CCGTCAATATCCTGGCATCGGAGGAGGGTCGCCAGCTGCGCCACTTGCAC
CAACGGAACGTCTCCTACCTGAAGAGCCTGCTGAAGCGAGAAGGTTTCCC
CGTCGAAGAAACGCCCAGCCACATCATTCCCATTAAGATCGGAGACCCTC
TGAAGAGCAGTCAAATCTCAAACGTGCTGATCGAACAATTCGGACACTAC
CTGCAGTCGATTAACTACCCAACCGTCGCCCGGGGCCAGGAGAAATTGCG
GCTGGCCCCCACCCCGTTCCACACTTTTGAAATGATGAACGCCCTGGTTA
CCGATCTAAAGAAAGTGTGGGAAATGGTGGACCTCTCTACAAACGTCCCT
CTTTCGCCCAACGCATGCATGTTCTGCAACTCGGAGAGCTGCTGGCACCA
GGACACCTCCCCGGATCTGGAGTGTGGCATTCCCAACTGCCCTCGCCTGG
AGATCTCGCTTGCAGCA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items