48 related 3
Fly Line IDF003318
Construct IDP006145
CG/CR NumberCG6913
SymbolFer3
Gene Name48 related 3
Gene SynonymsCG6913; nato3; Dnato3; BcDNA:LD04689; Fer3; bHLHa32
FBgnFBgn0037937
TypeORF-CC
PlasmidpGW-CC.attB
Sequence

ATGCAGCATCCACATCCCATTGACCAGCCCACCTACATGCCGGATGTTCC
ATTCCAGCCGCTTTGGGGTCAGGAGGCTCCACCGCCGCCCATTGTTCCAT
ACCAAGAGCTCATCGCCGGTTTTCCCTGCACCGACTTGTCTCTGTGGCAG
CGCTCGCAAGTAACTCCTTTGGTGCCCCAGCGTCCGTCGACAAATGGGAG
GGCCAACGGCTCCTCCAGCTCCTCGAAGAAAACGCGTCGCCGTGTGGCAT
CAATGGCCCAACGGAGAGCTGCAAATATCCGCGAACGCCGTCGCATGTTT
AACCTAAACGAGGCCTTCGACAAGTTGCGCCGCAAGGTGCCCACCTTCGC
CTACGAGAAACGACTGTCCCGCATCGAAACCCTTCGCTTGGCCATCACCT
ACATCGGATTCATGGCTGAGCTGCTGAGCGGCACGCCCTCGAACTCCCAC
AAATCGCGGTCCGACGTCTATGGGAGTATGAATGGTCACCATCAGGCGCC
ACCACCGGCAATTCATCCACATCATCTGCATCCGGCGGCGGCATATCAAC
GCGATTTCGCTTCGCCCTATAATCATAGTTTGTCC

Insertion SiteChr.2, attP 21F
Comments
Log in to add this item

0 items