wishful thinking
Fly Line IDF003561
Construct IDP007122
CG/CR NumberCG10776
Symbolwit
Gene Name wishful thinking
Gene SynonymsCG10776; STK-D; ALK3/BMPRII; l(3)64Aa; 1262/15; SE20; l(3
)SH12; l(3)S126215; Stk-D; wit; Wit; WIT; Wit-C; BMP
FBgnFBgn0024179
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAATTGGGCTATCTATCTTTTGTTGGCCCTGATCTCGCTGGGCAGAGC
AACACCTGTTCCCAATCGCCAGTATAGCTGTATGAGCTACCAGGAGGACG
ACAACTCATTTCACGATGATGATGGCGATCAGGACTCTAGTGGCGAGCTG
CAGGAGCAGCAGGTGGAGTCCACTCCGATTCCGAGCGAGCCACATAGACG
CACCTGCCCAGATGGCTACACTTTCTGTTTCACCATCTGGAACCAGACGG
CCAATGGAGCGCGGGTTGTTAAACAGGGTTGCTGGAAGGACAACACGGAT
CGCACTTCCATTTGCAGCCAGTCGGAATGTACCAGCTCGGCTCCCACCTC
GAAGACCAGTTCTTTGTACTACTGTTGCTGTTCGGGAGGAGTGTGCAATG
CCCAATATTCCGTGGTCGAACCGGCACCTCTGGAACTGGGCTCCAATGAG
GGACGGACTTCGATCACAAATCGGGCGACAGAAAAACAGCACCAGTCCTT
TTTGGCCAGTACAATGCTGGGCCTTGCCGGTGGACTCACAGCCCTCACAA
TCGGCATCTTTCTGGCTGTTCAATATTGCCGCACGGCCAAGGAGAAGCCG
GAACCGGAGGAGTCGCCTCTGGCACCATCGGGCCCTGGCTACAGTTCTAA
TCTCAGGAATGTCGACAACATGAATTTGATCGGCATGCTGGGGAGCGGCA
AGTATGGAACTGTGATGAAGGGACTGCTCCACGATCAGGAGGTGGCGGTT
AAGATATATCCCGAAGAGCATCATCAGTACTATGTGAACGAGAGGAACAT
CTATGCCTTGCCTTTGATGGAGTGTCCTGCGCTGTTGAGCTATTTCGGCT
ACGATGAACGCTGTACCATGGACGGGCGAATGGAGTATCAACTGGTACTA
TCACTGGCTCCCCTCGGATGCCTCCAGGATTGGTTGATAGCCAATACCCT
AACTTTCAGCGAATGCTGTGGAATGCTGCGGTCCATCACGCGTGGAATCT
CGCACCTGCACACGGAACTCCGACTGGGAGATCAGCATAAGCCCTGTGTG
GCTCATCGGGATATCAACACAAGGAATGTGTTGGTCCAAGCTGATCTCAG
CTGTTGCATTGCGGACTTTGGTTTCGCTCTCAAGGTGTTTGGCTCCAAGT
ACGAGTACAAGGGCGAGGTGGCCATGGCGGAAACGAAGAGCATCAATGAG
GTGGGCACCCTTCGCTACATGGCCCCAGAATTACTGGAAGGAGCTGTAAA
TCTGCGGGATTGCGAAACCTCGCTGAAGCAAATGGATGTCTATGCCCTGG
GCCTGGTGCTGTGGGAAGTGGCTACCCGCTGCTCGGATTTCTATGCCCCT
GGTCAAGCAACACCTCCCTACAAAGCACCCTATGAGCAGGAGGTGGGCTC
CCATCCCAGCTTTGATCAAATGCAGGCGTTGGTGGTGCGGCACAAGGCGC
GTCCCTTATTTCCCACCGGCTGGGGTGGAGGAGCAGCGGCTAAAGTGGTG
CGGGATACTTGCGAGGACTGTTGGGATCATGATGCGGATGCTAGGCTGAC
CTCCCTGTGTGCCGAGGAGCGCATGCAGGAGATGTCGACTTTAAGGCCAC
GAGCACAGGCTCAACCTTCCAGTCCACTGCTGAATACCAACAATCTGGTG
GCCAGTCCAACTGCGGAACAGGGAATAAATATCATAGCCACAACGACAAC
GGCGGCTGCAGTCCATCACCAGATGAGCTCCGACACTACGGGACTTATAC
AGCCACCTCCCAATCAGCAGATACCTCTAGCTGCCTTGGAACGGGAGAAG
AATCATCTGAGCTACCCGCAACAGCAATTGCAGCCGTATCAGGGCAGGAA
TCCCTGCCAGGAGCGCAATCTGGCACCTCTGACAATGCGAACTCCACCGG
TTCTTGTGGAGCGGAGCAAGAAGCACAGTTTCCAGACACAGCCTCAGGAG
AACTCACTGTCTTGCTTGGAGCATGATGTGAGTGTGGAGGAGCTGATAGC
CAGCCATCAGCACCAGCAGCAAAAGAACACGATTGTAAGCACAGGTGGAA
ATGGCAATTCCTGCTTGGGTCAGGGATTTCCCAAGCAGCAGAACACGGAT
CAAAAACTCCGGGGATGGCATGGAGTAAGAGCCCTGATCCACAAGAAACT
TTTTCGCAAAGAGCATGCCGAGGAGCTGTGTCGTCAGTTGCAGTTGGGCG
AAGAGAAGTCCAATCTGGTGACGGCTCTGCGTCGACCGAACAACCTGGAT
CTTAATCCTCGCCTCGATAAACCTCCGCCGGATCAGCTGAGGAGTGCAGA
GCAACGGATGGGAACTCCCGCTCACATTGTACCCCGATCGCTGTCCAGCA
GCCTGATCAAGCACATCAACGGGACCACCAACAATAACTCCATCCAGAGT
CATGGTAGCGAATTGCAGACCCTCACCCGTCCGGCTTCGAAGCGAAGACC
AGGTCACCTGCGCACCAACTCCCTGATGGCCACCACGGGTCAGGGTCCGC
CGACGGAGCAGCAAATGCGTCGTCAGCACAGTCTGGAGGTATTCCGTGAG
GTATTCAGCGGTCGGGGGAGCAGCGAGCGTTTGAGGGACCCCAGCGAGCG
GGTCAAGACGCCGGGAGATGTGCCACCATCCGTACGGAAAGCCAGGGCCA
GCAAGACACTGAGCTTGTACGACGATCGGATGATGGACTCCTCCCTGCTC
AACATTCTC

Insertion SiteChr.3, attP 86Fb
CommentsSequence based on a gene model from the Ensembl66 release
(FBtr0073279).
Log in to add this item

0 items