achintya
Fly Line IDF000280
Construct IDP000171
CG/CR NumberCG8819
Symbolachi
Gene Nameachintya
Gene SynonymsCG8819; zaa; achi; ach; Achi; vis; dTGIFb; achi/vis; dTGI
F; TGIF; dTGIFa
FBgnFBgn0033749
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGATCTCGCCGGAACAAGAAGAGGTCAACATGGTCCTGGATCGCCATGT
ACGGCAGAATATCCAGGACATGATGCACGAGGCTCATGTCCAGGCGAGCC
TGCTGGAGAACGAAGGACGCGGCCGTTTCCACTCGGACTCAAGTTTGGAC
CAGGATTCTCTTCACGCTGACGTCATCGTGGAGGAGGATCAGAGCACCGA
ACACGGCGCCAACCAGGTGCAAAACTACCACGACATGATGGTGGACAGTG
AACACCACATCGACATAAATGGGTCGCTGCGCAAACGTCGTGGAAATCTT
CCCAAGACCTCTGTAAAGATTTTAAAGCGTTGGCTTTATGAGCACCGCTA
TAACGCCTATCCGAGCGATGCGGAGAAGTTCACCCTGTCCCAGGAGGCCA
ATCTGACGGTGCTCCAAGTGTGCAACTGGTTCATCAATGCCCGTCGCCGC
ATTCTACCGGAGATGATCAGGCGCGAGGGCAACGATCCTCTGCACTTCAC
CATATCGCGACGTGGCAAAAAGGTTAGCCCCAACTGTTCGAGATCAAGTG
CGTTGGGCGCAAACTTGACTGGGCCGAATCCCGCACACGGAAGTCCTGCT
TCCGAAGTGGTCGTTGGCGCTACAGAGGAGGTGGATGGCGCCGGTGAGAT
TCACGAGGGCATCGCCAATGTGCTGACCAACTTTGAACAGTATGTGCAGG
GCCCCAACGGACAAATGGTCAAGATGGAGCCGGAGTACGAGGACAGTGTC
ATCTACAGGTCCGAAGGCGAAGAGAGTGCACAGGGATACGAGTCCTGTGG
GCCGAACAGCGAGGAGGAAGTACGCTTCGAGACCTCCCATGATTGGCAGA
GCGTTATAAAAACTGTATTTGGTACTGAGGAAGTCAGCACTTCGGCTGGC
AATAATCCAGGTACCTCTGGTTCTAAGGGATCTGTTCAGAATACCGCCAT
CTGGAATCGCAATCAGACTGCGAAGCGTGACGTGAATCAACAGTTGACTG
ACTTTGAAAGCGAGCTGAATAGAATACAGGCCTCAGAAATCCAGACAATC
GATCCTACCAACTCCAATCAACAGGACATTGGTGACAATCTACAGGCGGA
CGAGGTGTTTACCGGTGCCGAAGCAGAAGCTGGCCAGAGTCAATTATCTG
CTATGTCGCAGGGCACAAGTCCAGATGAGCGTGCCAAGTACAAGTGTCTC
TATTATCTAGTGGAAACTGCCATGGCTGTGCGCCAAAACGATGACGTCCA
GGATGACGATTTCGTTTACATGGGAGAC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items