Abdominal B
Fly Line IDF003377
Construct IDP006684
CG/CR NumberCG11648
SymbolAbd-B
Gene NameAbdominal B
Gene SynonymsAbd-B; AbdB; Fab7; Fab-7; iab-8; AdbB; iab-7; Abd-b; iab-
6; iab-5; AbdB-II; AbdB-I; abd-B; Abd B; iab6; Mcp; DROAB
DB; pH189; ABDB; AbdB(CA)[[26]]; abdB; MCP; FAB; Mc; iab9
; iab8; iab7; iab5; Tab; Sab; twig; unnamed; tuh-3; l(3)8
9Ed; iab; iab8.9; Uab-5[Sab]; CG10291; CG11648; Iab-7; IA
B5; IAB8; bex; IAB 5; Droabdb; BX-C; iab-8,9; ABD-B; Fab-
8; Fab-6; Abd0B; DmAbdB; Abdb; IAB7
FBgnFBgn0000015
TypeORF-CC
PlasmidpGW-CC.attB
Sequence

ATGTCCATACAATTAGCTCCACTGCATATACCCGCCATCCGGGCCGGTCC
GGGATTCGAGACGGACACCTCGGCGGCGGTCAAGCGGCACACGGCACACT
GGGCCTACAACGACGAGGGATTCAATCAGCATTACGGCTCCGGGTACTAC
GACCGCAAGCACATGTTCGCCTATCCTTACCCAGAAACGCAGTTTCCGGT
TGGTCAGTACTGGGGCCCCAACTACCGCCCCGATCAGACCACCTCTGCCG
CAGCGGCGGCGGCCTACATGAACGAAGCGGAGCGCCACGTGAGCGCCGCC
GCCCGACAGTCCGTCGAGGGCACATCGACGTCCAGCTATGAGCCGCCCAC
CTACTCCTCGCCAGGCGGCCTGCGCGGCTATCCCAGCGAGAACTACTCCA
GCTCAGGAGCCTCTGGTGGATTATCCGTGGGAGCAGTGGGTCCTTGCACG
CCCAATCCCGGACTGCACGAGTGGACCGGTCAGGTGTCCGTCCGGAAAAA
GCGCAAGCCGTACTCGAAGTTCCAGACCCTGGAGCTGGAGAAGGAGTTTC
TTTTCAATGCGTATGTTTCCAAGCAAAAGCGCTGGGAATTGGCCAGAAAT
TTGCAGCTGACCGAGCGACAGGTCAAGATATGGTTCCAGAATCGGCGCAT
GAAGAACAAGAAGAACTCACAGCGCCAGGCCAATCAGCAGAACAACAACA
ACAATTCGAGCAGCAACCACAACCACGCGCAGGCGACCCAGCAGCACCAC
AGCGGCCACCACCTGAACCTTAGCCTGAACATGGGTCACCATGCCGCCAA
GATGCACCAG

Insertion SiteChr.2, attP 21F
Comments
Log in to add this item

0 items