CG6276
Fly Line IDF000009
Construct IDP000182
CG/CR NumberCG6276
SymbolCG6276
Gene NameCG6276
Gene SynonymsCG6276
FBgnFBgn0038316
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGATGACGACCGACTTCGCGGGCAGCCAGTTCGTGTCCAGCAATCCCAA
CACCAGCTGTAGTGCATCCCGCTGGCTAACGGAGGAGGTCTTTAAACTAA
TCGAAATTGTGCAGCGCGACGAGGCCATCTACAATCCGAGGCACAAATAC
TACTTTTGCCGCCCGTACGTGGAGAACTTTTGGCGCGAGGTGGATTTGAA
GCTGGAAAAGAATCCGGGCGCCAGTCTGGCCAAGTGGACCAATTTGCGCA
TCTCGTTCCGACGAGAGTACACCAACTATCTGGAGGAAAAGGTGCCACCC
TGCTGGTCCTACTTCGACCGCATGTTCTTTCTGCATCCGTATCTACGCAA
GAAGCACCAGCAGCCCAAATCGCTGGACACACAGGTGCAGGACGCCCTGG
CACACCTCTCGAACCTTTCTAGTCGTATGCAGCGTGAGCGTTCAGTGACC
ATTCCGGGCAGCAGCAGTATTGGTGGCCAGCCCACGCCCTCCGCCCACCA
GTCACCACCTGCACAGCAGCTGGACAACTATCTGGACTACTTTGACGAGG
CGGAACACAACAACTCCGAGCTGGATGACATCATGGAGGAGGAGCAGCAG
CGCAACAGTCGTTACCACGGCCAGTTGGACGGCAACGACATTAAGTCGGA
GTGCGAGGAGCCGGTGGATGACTACGAACAAGAGGCGCACGAGCCCGAGG
AGGATGAACAGGATGACCAGGACCTACACAAGATGGCGCCTACTTCTAGC
TCTTCATCGGCGGAGGCCCAGCGTCGTTATGCCAACCAGCATTCACACGC
CAGCCGAATGCTTCCGGGTCGCCTCCAAATGCGCACCTACCATGACGAGA
TGCGTGGCGCTATTCGTCCGCGTTCCCAGGAACTCCAAGCTCCAACTGCA
GCAGTGGCCGGGGTCAACTACTCCGCACAGCCGACTGCCCATCCAAACAT
TTCGTTTGTGCGACCTACTTTCAGCAAGCCCGTGGATTTGGTTAGCACTA
CAACGCACGCCGGAGGCGGAGGAGGAGGAGGTGTTCCAGGAACTGCTGGC
TTATCCGAAGCGGAACTGCCCACACCATCCACTGCGGCCGTGGCCACCCC
GATGGCGCCCAGTAGTAGTGTTAGTGCCAGCAGTAGCAGTAGCTACTTGA
GTCAACGGCATGGGCACAACCATATGCATGGAGGACATCCACAGGTGCCG
CCGTCAGCGCTTCCTCTGCGTTTGGAAGCCAACAACGCGTCCGGCGGATC
CGTGTCCAACGGCGGTGCGGAGCTGTGCGACTGCAAGACCGATCCGGATG
CCATGTTTCTGATGAGCCTGCTGCCCGACATCCAAAAGCTGAACGGCCGT
GATCGCGGCAAGATAAAGATAGCCTTCCAGAACATCCTGCAGGACTACCT
GTATCCGGAT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items