Goosecoid
Fly Line IDF000017
Construct IDP000131
CG/CR NumberCG2851
SymbolGsc
Gene NameGoosecoid
Gene Synonymsgsc; D-gsc; D-Gsc; Pph25; 60Mun2; l(2)05341; 60Mun1; PPH2
5; M72; CG2851; Gsc
FBgnFBgn0010323
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTGGCACAAATGGTAGAGACAAATTCCCCGCCGGCGGGTTACACCCT
CAAAAGGTCGCCCAGCGATCTCGGCGAGCAGCAGCAGCCTCCAAGGCAGA
TCTCGCGATCTCCTGGCAACACGGCCGCCTATCACCTGACCACCGCCATG
CTCCTGAACTCGCAGCAATGCGGCTACTTGGGCCAGCGATTGCAGTCGGT
CCTCCAGCAGCAGCACGCCCAACACCAGCAGTCCCAAAGTCAAACTCCGT
CCTCCGATGATGGCAGCCAGTCAGGTGTCACCATTCTGGAAGAGGAGAGA
AGAGGAGGAGCCGCTGCCGCGTCTCTCTTCACTATTGACAGCATTTTGGG
CTCTCGCCAACAGGGTGGAGGCACCGCTCCAAGCCAAGGCAGCCACATCA
GCAGCAATGGCAACCAAAATGGACTCACCTCGAATGGCATCAGTTTGGGT
CTGAAAAGAAGTGGCGCCGAGTCCCCAGCCTCGCCAAATTCAAACTCCAG
TTCTAGCGCAGCCGCCAGTCCCATCCGACCGCAGAGGGTTCCTGCCATGC
TGCAGCATCCTGGCCTGCATCTGGGTCACTTGGCGGCTGCAGCGGCGAGC
GGTTTTGCCGCCTCTCCCTCGGATTTTTTGGTGGCGTACCCCAACTTCTA
TCCAAACTACATGCACGCTGCTGCGGTGGCGCATGTGGCCGCTGCTCAGA
TGCAGGCACATGTGAGTGGAGCAGCCGCTGGATTGTCGGGTCACGGGCAC
CATCCGCACCACCCCCATGGGCACCCCCACCATCCACATCTGGGCGCACA
CCACCACGGACAGCACCACCTCAGCCATCTGGGTCATGGACCTCCGCCGA
AGAGGAAGCGTCGCCATCGCACCATCTTCACGGAGGAGCAGTTGGAGCAA
CTGGAGGCCACCTTCGACAAAACACACTACCCAGATGTGGTGCTCCGGGA
GCAACTTGCCCTCAAGGTGGATCTCAAAGAAGAACGAGTTGAGGTGTGGT
TCAAGAACCGGCGGGCCAAGTGGCGCAAGCAAAAGCGCGAGGAGCAGGAG
CGGCTGCGGAAGCTGCAGGAGGAGCAATGCGGCAGCACCACCAACGGCAC
CACCAACAGCAGCAGCGGCACCACCAGCTCCACCGGCAACGGATCCCTAA
CCGTGAAGTGCCCCGGATCCGATCACTACTCCGCGCAGCTAGTGCACATC
AAGAGCGATCCCAATGGGTACAGCGATGCCGACGAGTCATCCGACCTGGA
AGTGGCC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items