tailup
Fly Line IDF000029
Construct IDP000118
CG/CR NumberCG10619
Symboltup
Gene Nametailup
Gene SynonymsCG10619; isl; islet; Isl; l(2)E41; l(2)37Aa; tup; Tup; Is
let
FBgnFBgn0003896
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGTAATGGCAGAGATTGGTGGCCATTTGGCTCACCAGCTACCGTTGCA
CAATCACAACCACAATCAAACTGGATTACAGCCATCGCTGGTGATGAACC
ATCATCTGGATTTGGATTGCCATGGACACGATGTGATAAAAAAACAACGC
CTATCTCACTGCGTCGGATGTGGCGGCCAGATCCACGATCAGTACATCTT
GCGCGTTGCCCCCGATCTGGAGTGGCATGCGGCGTGTCTGAAGTGCCAGG
AGTGCAGGCAGTTCCTGGACGAAAGCTGTACGTGTTTTGTGCGCGATGGC
AAGACCTACTGCAAGCGTGATTATGTTAGGTTATTTGGTACAAAATGTGA
TAAATGCGGCAACTCCTTCAGCAAAAATGATTTTGTGATGCGGGCCAAAA
CGAAAATCTTTCACATCGAGTGCTTTCGATGCTCCGCGTGTGCGCGACAA
TTGCTGCCAGGCGATGAATTCGCGTTACGCGATGCCGGGGCTTTGTACTG
CAAGGAGGATCACGATGTGCTGGAGAAATCGTCGCAGAGCAGCCTCACTT
CTTCGTCGGTGGAGAGCAACAACAATATTAGCAGTAGTAACAACAACAAC
ACCAACCTTAGCAATAACAACCATTCCAGCGAATTGGGTTCAATGTCAGA
TTCTGGCAGCGAATCGGGCTCACACAAAAGTATTAGGGACAAGCGACCCT
CGGGGCCATCGGATGGCAAGCCCACGCGGGTTCGGACCGTGCTCAATGAG
AAACAGCTGCATACGCTCAGAACCTGCTACAATGCTAATCCGCGACCTGA
TGCGCTCATGAAGGAGCAGCTGGTGGAGATGACGAGCCTGTCGCCGCGAG
TCATCCGAGTATGGTTCCAGAACAAGCGCTGCAAGGACAAGAAGAAGACC
ATTCAGATGAAGCTGCAAATGCAGCAGGAGAAGGAGGGTCGCAAGCTGGG
CTACGGCGCCATGCAGGGCATCCCCATGATCGCCAGTTCCCCGGTGCGGC
ATGACTCCCCACTGAATCTTCAGGGCCTGGATGTGCAGACATATCAACCG
CCATGGAAAGCCTTAAGCGACTTCGCCCTTCACGCCGATCTCGACAGCAA
TGGAGCGATCAATACCCACACGCCCGCATTTCAGCAGTTGGTCAATCAGA
TGCACGGCTACGACCTGAACGGGATGCCCATTCTGCCGCCGCATCCGCAC
TCGCATCCGGCGCAAGGACCTCCCCACCAGCACCCCCCGCCCCCCGGCGG
ACCGCACAACCATCAGAACCAGCAGCCGAACCAGCAGCCCGGAGGCAGCA
GTTTGGACTCCGGGATCACCTCGCACCACCATCCGGACAGCACCGACTCC
TACGTCACCTACCTGGAGAGCGATGACAGTATGCAGGGCAGTCCG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items