abdominal A
Fly Line IDF000044
Construct IDP000077
CG/CR NumberCG10325
Symbolabd-A
Gene Nameabdominal A
Gene Synonymsabd-A; abdA; Abd-A; iab-4; AbdA; iab-2; Cbxd; Abda; CG103
25; iab-3; DmabdA; iab4; abda; Hab; abd A; iab3; iab2; ab
d-a; iab-5; unnamed; l(3)89Ec; iab; BX-C; abd_a; Dmabda;
Fab-3; Fab-4
FBgnFBgn0000014
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTATCCGTACGTGTCTAACCACCCTAGCAGCCATGGAGGGCTCTCCGG
AATGGCCGGCTTCACCGGACTGGAGGATAAGTCGTGCAGCAGGTACACGG
ACACTGTCATGAACAGCTACCAGTCGATGAGCGTACCTGCCTCGGCATCT
GCACAGTTCGCTCAGTTCTATCAACATGCCACAGCCGCCGCATCCGCGGT
ATCCGCGGCCAGTGCCGGCGCGATCGGCGTGGACTCGCTGGGAAATGCCT
GCACACAGCCCGCCTCCGGCGTGATGCCAGGGGCAGGGGGAGCGGGCGGA
GCCGGTATCGCCGATCTGCCCAGGTATCCCTGGATGACGCTTACAGACTG
GATGGGAAGCCCCTTCGAGCGTGTCGTTTGTGGCGATTTCAACGGCCCCA
ACGGCTGTCCACGAAGGCGCGGTCGCCAGACCTACACTCGCTTCCAGACC
CTCGAACTGGAGAAGGAGTTTCACTTCAACCACTACTTAACTCGGCGAAG
GCGCATCGAGATCGCACATGCCCTCTGCCTGACCGAGCGACAGATCAAGA
TCTGGTTTCAGAACCGTCGCATGAAGCTGAAGAAGGAGTTACGAGCCGTC
AAGGAAATAAATGAACAGGCGCGACGCGATCGAGAGGAGCAGGAGAAAAT
GAAGGCCCAGGAGACGATGAAATCCGCCCAGCAGAACAAGCAAGTGCAAC
AGCAGCAGCAACAGCAACAGCAGCAGCAACAGCAGCAGCAGCAACAGCAC
CAACAGCAGCAACAACAGCCGCAGGACCACCACTCGATCATCGCACACAA
TCCAGGCCACTTGCACCACTCGGTGGTAGGTCAAAACGATCTCAAGCTCG
GCCTTGGCATGGGCGTGGGCGTCGGAGTGGGCGGCATCGGGCCGGGCATC
GGTGGCGGCTTGGGCGGCAATCTGGGCATGATGAGCGCCCTGGACAAGAG
CAATCACGACCTGCTAAAGGCGGTCAGCAAAGTCAACTCC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items